EMAIL THIS PAGE TO A FRIEND

KBTBD8

kelch repeat and BTB (POZ) domain containing 8

222 Gene Product Result for
Synonyms: TA-KRP
UniProtKB ID: Q8NFY9, Q96JI5
Gene ID:
Mouse(243574) kelch repeat and BTB (POZ) domain containing 8
Rat(500262) kelch repeat and BTB (POZ) domain containing 8
Zebrafish(559966) kelch repeat and BTB (POZ) domain containing 8
chicken(416085) kelch repeat and BTB (POZ) domain containing 8
cow(530516) kelch repeat and BTB (POZ) domain containing 8
Horse(100064087) kelch repeat and BTB (POZ) domain containing 8
domestic cat(101088471) kelch repeat and BTB (POZ) domain containing 8
dog(484697) kelch repeat and BTB (POZ) domain containing 8
sheep(101118139) kelch repeat and BTB (POZ) domain containing 8
domestic guinea pig(100719798) kelch repeat and BTB (POZ) domain containing 8
naked mole-rat(101713612) kelch repeat and BTB (POZ) domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032505 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001008785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072421 MISSION® esiRNA esiRNA targeting mouse Kbtbd8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032505 Rosetta Predictions human pricing
NM_001109250 Rosetta Predictions rat pricing
NM_001008785 Rosetta Predictions mouse pricing
NM_001102670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359989 predicted 667
2 SASI_Hs01_00088999 predicted 564
3 SASI_Hs02_00359990 predicted 1769
4 SASI_Hs01_00089001 predicted 1587
5 SASI_Hs01_00089002 predicted 1520
6 SASI_Hs01_00089003 predicted 1121
7 SASI_Hs02_00359991 predicted 1243
8 SASI_Hs01_00089005 predicted 1533
9 SASI_Hs01_00089006 predicted 264
10 SASI_Hs01_00089007 predicted 223
11 SASI_Hs01_00089000 predicted 824
12 SASI_Hs01_00089004 predicted 625
13 SASI_Hs01_00089008 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246564 predicted 877
2 SASI_Rn02_00246565 predicted 239
3 SASI_Rn02_00246566 predicted 1009
4 SASI_Rn02_00246567 predicted 1849
5 SASI_Rn02_00246568 predicted 1215
6 SASI_Rn02_00246569 predicted 1155
7 SASI_Rn02_00246570 predicted 325
8 SASI_Rn02_00246571 predicted 425
9 SASI_Rn02_00246572 predicted 1503
10 SASI_Rn02_00246573 predicted 1893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286845 predicted 886
2 SASI_Mm01_00159379 predicted 504
3 SASI_Mm01_00159382 predicted 1224
4 SASI_Mm02_00286846 predicted 807
5 SASI_Mm01_00159381 predicted 1933
6 SASI_Mm01_00159383 predicted 1662
7 SASI_Mm02_00286847 predicted 1531
8 SASI_Mm02_00286848 predicted 493
9 SASI_Mm02_00286849 predicted 644
10 SASI_Mm02_00286850 predicted 1511
11 SASI_Mm01_00159377 predicted 349
12 SASI_Mm01_00159378 predicted 279
13 SASI_Mm01_00159380 predicted 247
14 SASI_Mm01_00159384 predicted 311
15 SASI_Mm01_00159385 predicted 295
16 SASI_Mm01_00159386 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303079 predicted 676
2 SASI_Mm02_00303080 predicted 296
3 SASI_Mm02_00303081 predicted 1015
4 SASI_Mm02_00303082 predicted 604
5 SASI_Mm02_00303083 predicted 1717
6 SASI_Mm02_00303084 predicted 1452
7 SASI_Mm02_00303085 predicted 1316
8 SASI_Mm02_00303086 predicted 287
9 SASI_Mm02_00303087 predicted 431
10 SASI_Mm02_00303088 predicted 1307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032505
KBTBD8 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032505.2-1232s21c1
Sequence:CCGGTGCAATCGGAGGTCGTGTTTACTCGAGTAAACACGACCTCCGATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032505.2-1598s21c1
Sequence:CCGGTCCATGTGATCAGTCCATAAACTCGAGTTTATGGACTGATCACATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032505.1-3886s1c1
Sequence:CCGGCCTGCACAACAGTTGATCTTTCTCGAGAAAGATCAACTGTTGTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-202s1c1
Sequence:CCGGCCCTTACTTCAGATCCATGTTCTCGAGAACATGGATCTGAAGTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-1268s1c1
Sequence:CCGGCCAGTTGCAATGGAATTTCATCTCGAGATGAAATTCCATTGCAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-611s1c1
Sequence:CCGGCGAGAAGAGCATGTTTATGAACTCGAGTTCATAAACATGCTCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-391s1c1
Sequence:CCGGCCAAGACCAATGTGCTAAGTACTCGAGTACTTAGCACATTGGTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032505.1-119s1c1
Sequence:CCGGGAAGGACAGTTGACAGACATTCTCGAGAATGTCTGTCAACTGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032505
KBTBD8 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032505.2-1232s21c1
Sequence:CCGGTGCAATCGGAGGTCGTGTTTACTCGAGTAAACACGACCTCCGATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032505.2-1598s21c1
Sequence:CCGGTCCATGTGATCAGTCCATAAACTCGAGTTTATGGACTGATCACATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032505.1-3886s1c1
Sequence:CCGGCCTGCACAACAGTTGATCTTTCTCGAGAAAGATCAACTGTTGTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-202s1c1
Sequence:CCGGCCCTTACTTCAGATCCATGTTCTCGAGAACATGGATCTGAAGTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-1268s1c1
Sequence:CCGGCCAGTTGCAATGGAATTTCATCTCGAGATGAAATTCCATTGCAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-611s1c1
Sequence:CCGGCGAGAAGAGCATGTTTATGAACTCGAGTTCATAAACATGCTCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-391s1c1
Sequence:CCGGCCAAGACCAATGTGCTAAGTACTCGAGTACTTAGCACATTGGTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032505.1-119s1c1
Sequence:CCGGGAAGGACAGTTGACAGACATTCTCGAGAATGTCTGTCAACTGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032505
KBTBD8 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032505.2-1232s21c1
Sequence:CCGGTGCAATCGGAGGTCGTGTTTACTCGAGTAAACACGACCTCCGATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032505.2-1598s21c1
Sequence:CCGGTCCATGTGATCAGTCCATAAACTCGAGTTTATGGACTGATCACATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032505.1-3886s1c1
Sequence:CCGGCCTGCACAACAGTTGATCTTTCTCGAGAAAGATCAACTGTTGTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-202s1c1
Sequence:CCGGCCCTTACTTCAGATCCATGTTCTCGAGAACATGGATCTGAAGTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-1268s1c1
Sequence:CCGGCCAGTTGCAATGGAATTTCATCTCGAGATGAAATTCCATTGCAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-611s1c1
Sequence:CCGGCGAGAAGAGCATGTTTATGAACTCGAGTTCATAAACATGCTCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032505.1-391s1c1
Sequence:CCGGCCAAGACCAATGTGCTAAGTACTCGAGTACTTAGCACATTGGTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032505.1-119s1c1
Sequence:CCGGGAAGGACAGTTGACAGACATTCTCGAGAATGTCTGTCAACTGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008785
KBTBD8 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-1549s21c1
Sequence:CCGGCCTATGATATAGAGCTAAATACTCGAGTATTTAGCTCTATATCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008785.4-3087s21c1
Sequence:CCGGACAGTTAGTTAGGGATATTAACTCGAGTTAATATCCCTAACTAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008785.4-2280s1c1
Sequence:CCGGGATCCTCAGTCTTACTATTTACTCGAGTAAATAGTAAGACTGAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008785.4-518s1c1
Sequence:CCGGCTTTATCTTTGCTGATCATTACTCGAGTAATGATCAGCAAAGATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008785.4-3156s1c1
Sequence:CCGGCATTACTATGCCTACTATAACCTCGAGGTTATAGTAGGCATAGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-649s21c1
Sequence:CCGGTACTAGACAGTGACGATTTAACTCGAGTTAAATCGTCACTGTCTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-1226s21c1
Sequence:CCGGTGCAATTGGAGGGCGTGTTTACTCGAGTAAACACGCCCTCCAATTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-1041s21c1
Sequence:CCGGTCACCAGATAATGACATATACCTCGAGGTATATGTCATTATCTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008785.1-942s1c1
Sequence:CCGGCCACCAAATGACCTAAGAGAACTCGAGTTCTCTTAGGTCATTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008785.1-1499s1c1
Sequence:CCGGGCTAAATAAGTGGACTCGTAACTCGAGTTACGAGTCCACTTATTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008785
KBTBD8 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-1549s21c1
Sequence:CCGGCCTATGATATAGAGCTAAATACTCGAGTATTTAGCTCTATATCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008785.4-3087s21c1
Sequence:CCGGACAGTTAGTTAGGGATATTAACTCGAGTTAATATCCCTAACTAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008785.4-2280s1c1
Sequence:CCGGGATCCTCAGTCTTACTATTTACTCGAGTAAATAGTAAGACTGAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008785.4-518s1c1
Sequence:CCGGCTTTATCTTTGCTGATCATTACTCGAGTAATGATCAGCAAAGATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008785.4-3156s1c1
Sequence:CCGGCATTACTATGCCTACTATAACCTCGAGGTTATAGTAGGCATAGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-649s21c1
Sequence:CCGGTACTAGACAGTGACGATTTAACTCGAGTTAAATCGTCACTGTCTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-1226s21c1
Sequence:CCGGTGCAATTGGAGGGCGTGTTTACTCGAGTAAACACGCCCTCCAATTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-1041s21c1
Sequence:CCGGTCACCAGATAATGACATATACCTCGAGGTATATGTCATTATCTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008785.1-942s1c1
Sequence:CCGGCCACCAAATGACCTAAGAGAACTCGAGTTCTCTTAGGTCATTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008785.1-1499s1c1
Sequence:CCGGGCTAAATAAGTGGACTCGTAACTCGAGTTACGAGTCCACTTATTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008785
KBTBD8 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-1549s21c1
Sequence:CCGGCCTATGATATAGAGCTAAATACTCGAGTATTTAGCTCTATATCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008785.4-3087s21c1
Sequence:CCGGACAGTTAGTTAGGGATATTAACTCGAGTTAATATCCCTAACTAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008785.4-2280s1c1
Sequence:CCGGGATCCTCAGTCTTACTATTTACTCGAGTAAATAGTAAGACTGAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008785.4-518s1c1
Sequence:CCGGCTTTATCTTTGCTGATCATTACTCGAGTAATGATCAGCAAAGATAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008785.4-3156s1c1
Sequence:CCGGCATTACTATGCCTACTATAACCTCGAGGTTATAGTAGGCATAGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-649s21c1
Sequence:CCGGTACTAGACAGTGACGATTTAACTCGAGTTAAATCGTCACTGTCTAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-1226s21c1
Sequence:CCGGTGCAATTGGAGGGCGTGTTTACTCGAGTAAACACGCCCTCCAATTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008785.4-1041s21c1
Sequence:CCGGTCACCAGATAATGACATATACCTCGAGGTATATGTCATTATCTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008785.1-942s1c1
Sequence:CCGGCCACCAAATGACCTAAGAGAACTCGAGTTCTCTTAGGTCATTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008785.1-1499s1c1
Sequence:CCGGGCTAAATAAGTGGACTCGTAACTCGAGTTACGAGTCCACTTATTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)