EMAIL THIS PAGE TO A FRIEND

KCMF1

potassium channel modulatory factor 1

112 Gene Product Result for
Synonyms: DEBT91 FIGC PCMF ZZZ1
UniProtKB ID: Q9P0J7, Q4ZG04, Q53SC7, Q9BWK2, Q9H8P5, Q9UFE8
Gene ID:
Mouse(74287) potassium channel modulatory factor 1
Rat(684322) potassium channel modulatory factor 1
Zebrafish(393927) potassium channel modulatory factor 1
dog(475773) potassium channel modulatory factor 1
cow(613522) potassium channel modulatory factor 1
domestic cat(101084441) potassium channel modulatory factor 1
chicken(770239) potassium channel modulatory factor 1
sheep(101122775) potassium channel modulatory factor 1
domestic guinea pig(100731653) potassium channel modulatory factor 1
naked mole-rat(101709709) potassium channel modulatory factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020122 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020122 Rosetta Predictions human pricing
NM_001128192 Rosetta Predictions rat pricing
NM_019715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094238 predicted 883
2 SASI_Hs01_00094240 predicted 1551
3 SASI_Hs01_00094241 predicted 1474
4 SASI_Hs01_00094242 predicted 601
5 SASI_Hs01_00094244 predicted 1500
6 SASI_Hs01_00094245 predicted 863
7 SASI_Hs01_00094246 predicted 1474
8 SASI_Hs01_00094247 predicted 1314
9 SASI_Hs02_00352983 predicted 498
10 SASI_Hs02_00352984 predicted 893
11 SASI_Hs01_00094239 predicted 703
12 SASI_Hs01_00094243 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255100 predicted 408
2 SASI_Rn02_00255101 predicted 677
3 SASI_Rn02_00255102 predicted 393
4 SASI_Rn02_00255103 predicted 1257
5 SASI_Rn02_00255104 predicted 1156
6 SASI_Rn02_00255105 predicted 252
7 SASI_Rn02_00255106 predicted 1308
8 SASI_Rn02_00255107 predicted 608
9 SASI_Rn02_00255108 predicted 465
10 SASI_Rn02_00255109 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324828 predicted 434
2 SASI_Mm01_00083095 predicted 655
3 SASI_Mm01_00083096 predicted 1413
4 SASI_Mm01_00083098 predicted 1526
5 SASI_Mm01_00083099 predicted 931
6 SASI_Mm02_00324829 predicted 402
7 SASI_Mm01_00083100 predicted 1401
8 SASI_Mm02_00324830 predicted 885
9 SASI_Mm02_00324831 predicted 431
10 SASI_Mm01_00083102 predicted 1559
11 SASI_Mm01_00083097 predicted 698
12 SASI_Mm01_00083101 predicted 1593
13 SASI_Mm01_00083103 predicted 754
14 SASI_Mm01_00083104 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020122
VALIDATED
KCMF1 MISSION shRNA Bacterial Glycerol Stock
potassium channel modulatory factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020122.2-184s1c1
Sequence:CCGGGCATATTAACAAGGGTAGATTCTCGAGAATCTACCCTTGTTAATATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020122.2-547s1c1
Sequence:CCGGGCAGTTCTACTGGTGGACTTTCTCGAGAAAGTCCACCAGTAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020122.2-522s1c1
Sequence:CCGGCGTAGATCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGATCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020122.2-996s1c1
Sequence:CCGGCTGTCCACTTTAGTGCGTGAACTCGAGTTCACGCACTAAAGTGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020122.2-79s1c1
Sequence:CCGGGTCGCAGATATAAGTGTTTAACTCGAGTTAAACACTTATATCTGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020122.4-868s21c1
Sequence:CCGGGCAGTTCTACTGGTGGACTTTCTCGAGAAAGTCCACCAGTAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020122.4-843s21c1
Sequence:CCGGCGTAGATCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGATCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020122.4-400s21c1
Sequence:CCGGGTCGCAGATATAAGTGTTTAACTCGAGTTAAACACTTATATCTGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020122.4-505s21c1
Sequence:CCGGGCATATTAACAAGGGTAGATTCTCGAGAATCTACCCTTGTTAATATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020122
VALIDATED
KCMF1 MISSION shRNA shRNA Plasmid DNA
potassium channel modulatory factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020122.2-184s1c1
Sequence:CCGGGCATATTAACAAGGGTAGATTCTCGAGAATCTACCCTTGTTAATATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020122.2-547s1c1
Sequence:CCGGGCAGTTCTACTGGTGGACTTTCTCGAGAAAGTCCACCAGTAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020122.2-522s1c1
Sequence:CCGGCGTAGATCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGATCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020122.2-996s1c1
Sequence:CCGGCTGTCCACTTTAGTGCGTGAACTCGAGTTCACGCACTAAAGTGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020122.2-79s1c1
Sequence:CCGGGTCGCAGATATAAGTGTTTAACTCGAGTTAAACACTTATATCTGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020122.4-868s21c1
Sequence:CCGGGCAGTTCTACTGGTGGACTTTCTCGAGAAAGTCCACCAGTAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020122.4-843s21c1
Sequence:CCGGCGTAGATCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGATCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020122.4-400s21c1
Sequence:CCGGGTCGCAGATATAAGTGTTTAACTCGAGTTAAACACTTATATCTGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020122.4-505s21c1
Sequence:CCGGGCATATTAACAAGGGTAGATTCTCGAGAATCTACCCTTGTTAATATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020122
VALIDATED
KCMF1 MISSION shRNA Lentiviral Transduction Particles
potassium channel modulatory factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020122.2-184s1c1
Sequence:CCGGGCATATTAACAAGGGTAGATTCTCGAGAATCTACCCTTGTTAATATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020122.2-547s1c1
Sequence:CCGGGCAGTTCTACTGGTGGACTTTCTCGAGAAAGTCCACCAGTAGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020122.2-522s1c1
Sequence:CCGGCGTAGATCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGATCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020122.2-996s1c1
Sequence:CCGGCTGTCCACTTTAGTGCGTGAACTCGAGTTCACGCACTAAAGTGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020122.2-79s1c1
Sequence:CCGGGTCGCAGATATAAGTGTTTAACTCGAGTTAAACACTTATATCTGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020122.4-868s21c1
Sequence:CCGGGCAGTTCTACTGGTGGACTTTCTCGAGAAAGTCCACCAGTAGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020122.4-843s21c1
Sequence:CCGGCGTAGATCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGATCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020122.4-400s21c1
Sequence:CCGGGTCGCAGATATAAGTGTTTAACTCGAGTTAAACACTTATATCTGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020122.4-505s21c1
Sequence:CCGGGCATATTAACAAGGGTAGATTCTCGAGAATCTACCCTTGTTAATATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019715
VALIDATED
KCMF1 MISSION shRNA Bacterial Glycerol Stock
potassium channel modulatory factor 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019715.1-2012s1c1
Sequence:CCGGCCCAGCGTTATCCAATGGTTACTCGAGTAACCATTGGATAACGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019715.1-1428s1c1
Sequence:CCGGGCTGTGTAGATATTATGCCTTCTCGAGAAGGCATAATATCTACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019715.1-975s1c1
Sequence:CCGGCTGAGCTGTTATCTCAGTTATCTCGAGATAACTGAGATAACAGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019715.1-875s1c1
Sequence:CCGGCGGAGATCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGATCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019715.1-761s1c1
Sequence:CCGGGCAGCTCATCTGACACTTGAACTCGAGTTCAAGTGTCAGATGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019715.2-1222s21c1
Sequence:CCGGTCCTGTTAACAAGGTTGAATGCTCGAGCATTCAACCTTGTTAACAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019715.2-499s21c1
Sequence:CCGGACCCGATGCAGTGCATATTAACTCGAGTTAATATGCACTGCATCGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019715
VALIDATED
KCMF1 MISSION shRNA shRNA Plasmid DNA
potassium channel modulatory factor 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019715.1-2012s1c1
Sequence:CCGGCCCAGCGTTATCCAATGGTTACTCGAGTAACCATTGGATAACGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019715.1-1428s1c1
Sequence:CCGGGCTGTGTAGATATTATGCCTTCTCGAGAAGGCATAATATCTACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019715.1-975s1c1
Sequence:CCGGCTGAGCTGTTATCTCAGTTATCTCGAGATAACTGAGATAACAGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019715.1-875s1c1
Sequence:CCGGCGGAGATCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGATCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019715.1-761s1c1
Sequence:CCGGGCAGCTCATCTGACACTTGAACTCGAGTTCAAGTGTCAGATGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000452932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019715.2-1222s21c1
Sequence:CCGGTCCTGTTAACAAGGTTGAATGCTCGAGCATTCAACCTTGTTAACAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019715.2-499s21c1
Sequence:CCGGACCCGATGCAGTGCATATTAACTCGAGTTAATATGCACTGCATCGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019715
VALIDATED
KCMF1 MISSION shRNA Lentiviral Transduction Particles
potassium channel modulatory factor 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019715.1-2012s1c1
Sequence:CCGGCCCAGCGTTATCCAATGGTTACTCGAGTAACCATTGGATAACGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019715.1-1428s1c1
Sequence:CCGGGCTGTGTAGATATTATGCCTTCTCGAGAAGGCATAATATCTACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019715.1-975s1c1
Sequence:CCGGCTGAGCTGTTATCTCAGTTATCTCGAGATAACTGAGATAACAGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019715.1-875s1c1
Sequence:CCGGCGGAGATCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGATCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019715.1-761s1c1
Sequence:CCGGGCAGCTCATCTGACACTTGAACTCGAGTTCAAGTGTCAGATGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019715.2-1222s21c1
Sequence:CCGGTCCTGTTAACAAGGTTGAATGCTCGAGCATTCAACCTTGTTAACAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019715.2-499s21c1
Sequence:CCGGACCCGATGCAGTGCATATTAACTCGAGTTAATATGCACTGCATCGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)