EMAIL THIS PAGE TO A FRIEND

KCNA1

potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)

366 Gene Product Result for
Synonyms: AEMK EA1 HBK1 HUK1 KV1.1 MBK1 MK1 RBK1
UniProtKB ID: Q09470, A6NM83, Q3MIQ9
Gene ID:
Human(3736) Summary: This gene encodes a voltage-gated delayed potassium channel that is phylogenetically related to the Drosophila Shaker channel. The encoded protein has six putative transmembrane segments (S1-S6), and the loop between S5 and S6 forms the pore and contains the conserved selectivity filter motif (GYGD). The functional channel is a homotetramer. The N-terminus of the channel is associated with beta subunits that can modify the inactivation properties of the channel as well as affect expression levels. The C-terminus of the channel is complexed to a PDZ domain protein that is responsible for channel targeting. Mutations in this gene have been associated with myokymia with periodic ataxia (AEMK). [provided by RefSeq, Jul 2008]
Mouse(16485) potassium voltage-gated channel, shaker-related subfamily, member 1
Rat(24520) potassium voltage-gated channel, shaker-related subfamily, member 1
Domestic Rabbit(100037722) potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
Domestic Rabbit(100037717) potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
domestic guinea pig(100731979) potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
Zebrafish(327087) potassium voltage-gated channel, shaker-related subfamily, member 1
cow(538703) potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
Horse(100051648) potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
domestic cat(101093364) potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
dog(486732) potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
chicken(428101) potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
C1055 Cromakalim rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D9035 Diazoxide human, mouse, rat pricing
P154 Pinacidil monohydrate powder mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000217 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000217 Rosetta Predictions human pricing
NM_173095 Rosetta Predictions rat pricing
NM_010595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051328 predicted 2130
2 SASI_Hs01_00051332 predicted 2049
3 SASI_Hs01_00051333 predicted 2230
4 SASI_Hs02_00302106 predicted 1295
5 SASI_Hs02_00302107 predicted 3052
6 SASI_Hs02_00302108 predicted 2964
7 SASI_Hs02_00302109 predicted 2961
8 SASI_Hs02_00302110 predicted 2244
9 SASI_Hs02_00302111 predicted 2024
10 SASI_Hs02_00302112 predicted 3020
11 SASI_Hs01_00051329 predicted 739
12 SASI_Hs01_00051330 predicted 1135
13 SASI_Hs01_00051331 predicted 629
14 SASI_Hs01_00051334 predicted 1047
15 SASI_Hs01_00051335 predicted 1042
16 SASI_Hs01_00051336 predicted 1175
17 SASI_Hs01_00051337 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045730 predicted 1058
2 SASI_Rn01_00045731 predicted 249
3 SASI_Rn02_00269243 predicted 911
4 SASI_Rn01_00045732 predicted 1179
5 SASI_Rn01_00045733 predicted 660
6 SASI_Rn01_00045734 predicted 1164
7 SASI_Rn01_00045735 predicted 1388
8 SASI_Rn01_00045736 predicted 1442
9 SASI_Rn01_00045738 predicted 626
10 SASI_Rn01_00045739 predicted 1369
11 SASI_Rn01_00045737 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196827 predicted 3100
2 SASI_Mm01_00196829 predicted 3230
3 SASI_Mm01_00196828 predicted 3485
4 SASI_Mm01_00196830 predicted 3464
5 SASI_Mm01_00196832 predicted 3430
6 SASI_Mm02_00318905 predicted 3204
7 SASI_Mm02_00318906 predicted 2885
8 SASI_Mm01_00196833 predicted 2264
9 SASI_Mm01_00196834 predicted 3416
10 SASI_Mm01_00196835 predicted 3355
11 SASI_Mm01_00196831 predicted 2043
12 SASI_Mm01_00196836 predicted 2453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000217
KCNA1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000217.2-2960s21c1
Sequence:CCGGCAGAACAAGATGATCACTTAGCTCGAGCTAAGTGATCATCTTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-624s1c1
Sequence:CCGGCACGGTCATCTACAATTCCAACTCGAGTTGGAATTGTAGATGACCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-948s1c1
Sequence:CCGGCCAGACCCTCAAAGCTAGTATCTCGAGATACTAGCTTTGAGGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-1336s1c1
Sequence:CCGGTCCTCTACTATGAGCAAGTATCTCGAGATACTTGCTCATAGTAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-195s1c1
Sequence:CCGGCCCTAAGAAACGCATGCGCTACTCGAGTAGCGCATGCGTTTCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-1113s1c1
Sequence:CCGGCACTGTAGGATACGGTGACATCTCGAGATGTCACCGTATCCTACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000217.2-2703s21c1
Sequence:CCGGTAGACTTGGAATGCTCTATTTCTCGAGAAATAGAGCATTCCAAGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000217
KCNA1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000217.2-2960s21c1
Sequence:CCGGCAGAACAAGATGATCACTTAGCTCGAGCTAAGTGATCATCTTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-624s1c1
Sequence:CCGGCACGGTCATCTACAATTCCAACTCGAGTTGGAATTGTAGATGACCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-948s1c1
Sequence:CCGGCCAGACCCTCAAAGCTAGTATCTCGAGATACTAGCTTTGAGGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-1336s1c1
Sequence:CCGGTCCTCTACTATGAGCAAGTATCTCGAGATACTTGCTCATAGTAGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-195s1c1
Sequence:CCGGCCCTAAGAAACGCATGCGCTACTCGAGTAGCGCATGCGTTTCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-1113s1c1
Sequence:CCGGCACTGTAGGATACGGTGACATCTCGAGATGTCACCGTATCCTACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000217.2-2703s21c1
Sequence:CCGGTAGACTTGGAATGCTCTATTTCTCGAGAAATAGAGCATTCCAAGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000217
KCNA1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000217.2-2960s21c1
Sequence:CCGGCAGAACAAGATGATCACTTAGCTCGAGCTAAGTGATCATCTTGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-624s1c1
Sequence:CCGGCACGGTCATCTACAATTCCAACTCGAGTTGGAATTGTAGATGACCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-948s1c1
Sequence:CCGGCCAGACCCTCAAAGCTAGTATCTCGAGATACTAGCTTTGAGGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-1336s1c1
Sequence:CCGGTCCTCTACTATGAGCAAGTATCTCGAGATACTTGCTCATAGTAGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-195s1c1
Sequence:CCGGCCCTAAGAAACGCATGCGCTACTCGAGTAGCGCATGCGTTTCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000217.1-1113s1c1
Sequence:CCGGCACTGTAGGATACGGTGACATCTCGAGATGTCACCGTATCCTACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000217.2-2703s21c1
Sequence:CCGGTAGACTTGGAATGCTCTATTTCTCGAGAAATAGAGCATTCCAAGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010595
KCNA1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010595.3-3716s21c1
Sequence:CCGGGAAGCTTTCAAGATCCATTAACTCGAGTTAATGGATCTTGAAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010595.3-3989s21c1
Sequence:CCGGGATGACCACTTAGGAATATAACTCGAGTTATATTCCTAAGTGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-2353s1c1
Sequence:CCGGGCTCCATGTTAGTTCTCCTAACTCGAGTTAGGAGAACTAACATGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-1687s1c1
Sequence:CCGGCGACAACACCACAGTCATCTACTCGAGTAGATGACTGTGGTGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-1180s1c1
Sequence:CCGGCGAGCGCGTAGTAATCAACATCTCGAGATGTTGATTACTACGCGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-2469s1c1
Sequence:CCGGCCCATTACAGACAGGCTAATACTCGAGTATTAGCCTGTCTGTAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010595.2-2618s1c1
Sequence:CCGGGCTCTGTAGATACTTTACTAACTCGAGTTAGTAAAGTATCTACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010595
KCNA1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010595.3-3716s21c1
Sequence:CCGGGAAGCTTTCAAGATCCATTAACTCGAGTTAATGGATCTTGAAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010595.3-3989s21c1
Sequence:CCGGGATGACCACTTAGGAATATAACTCGAGTTATATTCCTAAGTGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-2353s1c1
Sequence:CCGGGCTCCATGTTAGTTCTCCTAACTCGAGTTAGGAGAACTAACATGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-1687s1c1
Sequence:CCGGCGACAACACCACAGTCATCTACTCGAGTAGATGACTGTGGTGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-1180s1c1
Sequence:CCGGCGAGCGCGTAGTAATCAACATCTCGAGATGTTGATTACTACGCGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-2469s1c1
Sequence:CCGGCCCATTACAGACAGGCTAATACTCGAGTATTAGCCTGTCTGTAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010595.2-2618s1c1
Sequence:CCGGGCTCTGTAGATACTTTACTAACTCGAGTTAGTAAAGTATCTACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010595
KCNA1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010595.3-3716s21c1
Sequence:CCGGGAAGCTTTCAAGATCCATTAACTCGAGTTAATGGATCTTGAAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010595.3-3989s21c1
Sequence:CCGGGATGACCACTTAGGAATATAACTCGAGTTATATTCCTAAGTGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-2353s1c1
Sequence:CCGGGCTCCATGTTAGTTCTCCTAACTCGAGTTAGGAGAACTAACATGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-1687s1c1
Sequence:CCGGCGACAACACCACAGTCATCTACTCGAGTAGATGACTGTGGTGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-1180s1c1
Sequence:CCGGCGAGCGCGTAGTAATCAACATCTCGAGATGTTGATTACTACGCGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010595.2-2469s1c1
Sequence:CCGGCCCATTACAGACAGGCTAATACTCGAGTATTAGCCTGTCTGTAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010595.2-2618s1c1
Sequence:CCGGGCTCTGTAGATACTTTACTAACTCGAGTTAGTAAAGTATCTACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)