EMAIL THIS PAGE TO A FRIEND

KCNA2

potassium voltage-gated channel, shaker-related subfamily, member 2

64 Gene Product Result for
Synonyms: HBK5 HK4 HUKIV KV1.2 MK2 NGK1 RBK2
UniProtKB ID: P16389, Q86XG6
Gene ID:
Human(3737) Summary: Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]
Mouse(16490) potassium voltage-gated channel, shaker-related subfamily, member 2
Rat(25468) potassium voltage-gated channel, shaker-related subfamily, member 2
Zebrafish(100537815) potassium voltage-gated channel, shaker-related subfamily, member 2
dog(404022) potassium voltage-gated channel, shaker-related subfamily, member 2
cow(539608) potassium voltage-gated channel, shaker-related subfamily, member 2
domestic cat(101083868) potassium voltage-gated channel, shaker-related subfamily, member 2
chicken(395117) potassium voltage-gated channel, shaker-related subfamily, member 2
domestic guinea pig(100735605) potassium voltage-gated channel, shaker-related subfamily, member 2
naked mole-rat(101717332) potassium voltage-gated channel, shaker-related subfamily, member 2
sheep(101112012) potassium voltage-gated channel, shaker-related subfamily, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004974 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004974 Rosetta Predictions human pricing
NM_012970 Rosetta Predictions rat pricing
NM_008417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130028 predicted 1789
2 SASI_Hs01_00130029 predicted 806
3 SASI_Hs01_00130030 predicted 641
4 SASI_Hs01_00130031 predicted 1686
5 SASI_Hs01_00130032 predicted 1843
6 SASI_Hs01_00130034 predicted 1679
7 SASI_Hs01_00130036 predicted 1845
8 SASI_Hs01_00130037 predicted 634
9 SASI_Hs02_00338678 predicted 604
10 SASI_Hs02_00338679 predicted 1387
11 SASI_Hs01_00130033 predicted 1834
12 SASI_Hs01_00130035 predicted 1393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032741 predicted 1939
2 SASI_Rn02_00260573 predicted 1918
3 SASI_Rn01_00032742 predicted 1552
4 SASI_Rn01_00032743 predicted 720
5 SASI_Rn01_00032744 predicted 2070
6 SASI_Rn01_00032745 predicted 884
7 SASI_Rn01_00032746 predicted 1978
8 SASI_Rn01_00032747 predicted 1467
9 SASI_Rn01_00032749 predicted 1731
10 SASI_Rn01_00032750 predicted 1801
11 SASI_Rn01_00032748 predicted 2094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144877 predicted 989
2 SASI_Mm01_00144878 predicted 985
3 SASI_Mm02_00313870 predicted 2011
4 SASI_Mm01_00144879 predicted 2067
5 SASI_Mm01_00144880 predicted 1651
6 SASI_Mm01_00144881 predicted 825
7 SASI_Mm01_00144882 predicted 1565
8 SASI_Mm01_00144883 predicted 1572
9 SASI_Mm01_00144884 predicted 1857
10 SASI_Mm01_00144885 predicted 1461
11 SASI_Mm01_00144876 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004974
KCNA2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-679s1c1
Sequence:CCGGCCCAAAGAAACGAATGAGGTACTCGAGTACCTCATTCGTTTCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-1949s1c1
Sequence:CCGGGCTAACACAAACTATGTGAATCTCGAGATTCACATAGTTTGTGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-976s1c1
Sequence:CCGGGCCTGCCAGGATTATAGCTATCTCGAGATAGCTATAATCCTGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-797s1c1
Sequence:CCGGCCTGTGAATGTGCCCTTAGATCTCGAGATCTAAGGGCACATTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004974.2-1850s21c1
Sequence:CCGGACCATTAGTAAGTCTGATTACCTCGAGGTAATCAGACTTACTAATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004974.2-1883s21c1
Sequence:CCGGGAGGGTGTAAATAACAGTAATCTCGAGATTACTGTTATTTACACCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-1786s1c1
Sequence:CCGGGCAAGTGACAAGCTGTCCAAACTCGAGTTTGGACAGCTTGTCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004974
KCNA2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-679s1c1
Sequence:CCGGCCCAAAGAAACGAATGAGGTACTCGAGTACCTCATTCGTTTCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-1949s1c1
Sequence:CCGGGCTAACACAAACTATGTGAATCTCGAGATTCACATAGTTTGTGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-976s1c1
Sequence:CCGGGCCTGCCAGGATTATAGCTATCTCGAGATAGCTATAATCCTGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-797s1c1
Sequence:CCGGCCTGTGAATGTGCCCTTAGATCTCGAGATCTAAGGGCACATTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004974.2-1850s21c1
Sequence:CCGGACCATTAGTAAGTCTGATTACCTCGAGGTAATCAGACTTACTAATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004974.2-1883s21c1
Sequence:CCGGGAGGGTGTAAATAACAGTAATCTCGAGATTACTGTTATTTACACCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-1786s1c1
Sequence:CCGGGCAAGTGACAAGCTGTCCAAACTCGAGTTTGGACAGCTTGTCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004974
KCNA2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-679s1c1
Sequence:CCGGCCCAAAGAAACGAATGAGGTACTCGAGTACCTCATTCGTTTCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-1949s1c1
Sequence:CCGGGCTAACACAAACTATGTGAATCTCGAGATTCACATAGTTTGTGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-976s1c1
Sequence:CCGGGCCTGCCAGGATTATAGCTATCTCGAGATAGCTATAATCCTGGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-797s1c1
Sequence:CCGGCCTGTGAATGTGCCCTTAGATCTCGAGATCTAAGGGCACATTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004974.2-1850s21c1
Sequence:CCGGACCATTAGTAAGTCTGATTACCTCGAGGTAATCAGACTTACTAATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004974.2-1883s21c1
Sequence:CCGGGAGGGTGTAAATAACAGTAATCTCGAGATTACTGTTATTTACACCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004974.2-1786s1c1
Sequence:CCGGGCAAGTGACAAGCTGTCCAAACTCGAGTTTGGACAGCTTGTCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008417
KCNA2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008417.2-2241s1c1
Sequence:CCGGGCCTGCATTGTAGTCAGTGTTCTCGAGAACACTGACTACAATGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-2035s1c1
Sequence:CCGGCTACCATAAGTAAGTCTGATTCTCGAGAATCAGACTTACTTATGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-996s1c1
Sequence:CCGGCCCTTAGATATCTTCTCGGAACTCGAGTTCCGAGAAGATATCTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-809s1c1
Sequence:CCGGGCGGTTCGAAACTCAGCTAAACTCGAGTTTAGCTGAGTTTCGAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-1168s1c1
Sequence:CCGGCCAGGATTATAGCCATTGTATCTCGAGATACAATGGCTATAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008417.4-2059s21c1
Sequence:CCGGGAGATACAGGAGGGAGTTAACCTCGAGGTTAACTCCCTCCTGTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008417.4-2176s21c1
Sequence:CCGGGTCTGATTGAAGCCTACTAATCTCGAGATTAGTAGGCTTCAATCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008417
KCNA2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008417.2-2241s1c1
Sequence:CCGGGCCTGCATTGTAGTCAGTGTTCTCGAGAACACTGACTACAATGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-2035s1c1
Sequence:CCGGCTACCATAAGTAAGTCTGATTCTCGAGAATCAGACTTACTTATGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-996s1c1
Sequence:CCGGCCCTTAGATATCTTCTCGGAACTCGAGTTCCGAGAAGATATCTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-809s1c1
Sequence:CCGGGCGGTTCGAAACTCAGCTAAACTCGAGTTTAGCTGAGTTTCGAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-1168s1c1
Sequence:CCGGCCAGGATTATAGCCATTGTATCTCGAGATACAATGGCTATAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008417.4-2059s21c1
Sequence:CCGGGAGATACAGGAGGGAGTTAACCTCGAGGTTAACTCCCTCCTGTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008417.4-2176s21c1
Sequence:CCGGGTCTGATTGAAGCCTACTAATCTCGAGATTAGTAGGCTTCAATCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008417
KCNA2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008417.2-2241s1c1
Sequence:CCGGGCCTGCATTGTAGTCAGTGTTCTCGAGAACACTGACTACAATGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-2035s1c1
Sequence:CCGGCTACCATAAGTAAGTCTGATTCTCGAGAATCAGACTTACTTATGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-996s1c1
Sequence:CCGGCCCTTAGATATCTTCTCGGAACTCGAGTTCCGAGAAGATATCTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-809s1c1
Sequence:CCGGGCGGTTCGAAACTCAGCTAAACTCGAGTTTAGCTGAGTTTCGAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008417.2-1168s1c1
Sequence:CCGGCCAGGATTATAGCCATTGTATCTCGAGATACAATGGCTATAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008417.4-2059s21c1
Sequence:CCGGGAGATACAGGAGGGAGTTAACCTCGAGGTTAACTCCCTCCTGTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008417.4-2176s21c1
Sequence:CCGGGTCTGATTGAAGCCTACTAATCTCGAGATTAGTAGGCTTCAATCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)