EMAIL THIS PAGE TO A FRIEND

KCNA3

potassium voltage-gated channel, shaker-related subfamily, member 3

158 Gene Product Result for
Synonyms: HGK5 HLK3 HPCN3 HUKIII KV1.3 MK3 PCN3
UniProtKB ID: P22001, Q5VWN2
Gene ID:
Human(3738) Summary: Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]
Mouse(16491) potassium voltage-gated channel, shaker-related subfamily, member 3
Rat(29731) potassium voltage-gated channel, shaker-related subfamily, member 3
sheep(101105466) potassium voltage-gated channel, shaker-related subfamily, member 3
Domestic Rabbit(100328945) potassium voltage-gated channel, shaker-related subfamily, member 3
domestic guinea pig(100721847) potassium voltage-gated channel, shaker-related subfamily, member 3
naked mole-rat(101719045) potassium voltage-gated channel, shaker-related subfamily, member 3
chicken(404303) potassium voltage-gated channel, shaker-related subfamily, member 3
domestic cat(101092201) potassium voltage-gated channel, shaker-related subfamily, member 3
cow(525507) potassium voltage-gated channel, shaker-related subfamily, member 3
dog(490110) potassium voltage-gated channel, shaker-related subfamily, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA016625 Anti-KCNA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501619 Anti-KV1.3 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4504254 Anti-phospho-Kv1.3/KCNA3 (pTyr135) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
P9107 Anti-Potassium Channel Kv1.3 (Charybdotoxin-Sensitive Voltage-Dependent Potassium Channel, HLK3) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human, rat, mouse
immunocytochemistry, western blot pricing
P4497 Anti-Potassium Channel Kv1.3 (extracellular) antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat
flow cytometry, western blot pricing
P4247 Anti-Potassium Channel Kv1.3 (extracellular)−FITC antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, human, rat
flow cytometry, western blot pricing
AB5178 Anti-Potassium Channel Kv1.3 Antibody clone, Chemicon®, from rabbit mouse, human, rat
immunohistochemistry, western blot pricing
AB5589 Anti-Potassium Channel Kv1.3 Antibody, extracellular domain clone, Chemicon®, from rabbit human, rat
flow cytometry, western blot pricing
WH0003738M1 Monoclonal Anti-KCNA3 antibody produced in mouse clone 1D8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
D7148 3,4-Diaminopyridine ≥98% human pricing
36687 4-Aminopyridine PESTANAL®, analytical standard human pricing
1162454 Dalfampridine United States Pharmacopeia (USP) Reference Standard human pricing
PH016683 Guanidine AldrichCPR human pricing
G11659 Guanidine carbonate salt 99% human pricing
50930 Guanidine carbonate salt purum, ≥97.0% (NT) human pricing
G3272 Guanidine hydrochloride for molecular biology, ≥99% human pricing
G4505 Guanidine hydrochloride organic base and chaeotropic agent, ≥99% (titration) human pricing
50950 Guanidine hydrochloride ≥98% human pricing
PHG0006 Guanidine hydrochloride PharmaGrade, Manufactured under appropriate controls for use as a raw material in pharma or biopharmaceutical production. human pricing
50933 Guanidine hydrochloride BioUltra, for molecular biology, ≥99.5% (AT) human pricing
RDD001 Guanidine hydrochloride anhydrous, free-flowing, Redi-Dri, ≥99% human pricing
50940 Guanidine hydrochloride ≥99.0% (AT) human pricing
V900385 Guanidine hydrochloride Vetec reagent grade, ≥98% human pricing
12-1660 Guanidine hydrochloride SAJ special grade, ≥99.0% human pricing
12-1665 Guanidine hydrochloride ≥99.5% human pricing
G11705 Guanidine hydrochloride 92% human pricing
G7153 Guanidine hydrochloride BioXtra, ≥99.5% (titration) human pricing
G4630 Guanidine hydrochloride ≥98% human pricing
G9284 Guanidine hydrochloride solution human pricing
50937 Guanidine hydrochloride solution BioUltra, ~8 M in H2O human pricing
275875 4-Aminopyridine ≥99% human, mouse, rat pricing
A78403 4-Aminopyridine 98% human, mouse, rat pricing
C7802 Charybdotoxin ≥90% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154611 MISSION® esiRNA esiRNA human KCNA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002232 Rosetta Predictions human pricing
NM_019270 Rosetta Predictions rat pricing
NM_008418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050074 predicted 1775
2 SASI_Hs01_00050075 predicted 2193
3 SASI_Hs02_00333466 predicted 2199
4 SASI_Hs01_00050076 predicted 1589
5 SASI_Hs01_00050077 predicted 1963
6 SASI_Hs01_00050078 predicted 1619
7 SASI_Hs01_00050079 predicted 1790
8 SASI_Hs01_00050080 predicted 2219
9 SASI_Hs01_00050081 predicted 2250
10 SASI_Hs01_00050083 predicted 1821
11 SASI_Hs01_00050082 predicted 2175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262174 predicted 1250
2 SASI_Rn02_00262175 predicted 404
3 SASI_Rn02_00262176 predicted 561
4 SASI_Rn02_00262177 predicted 657
5 SASI_Rn02_00262178 predicted 1202
6 SASI_Rn02_00262179 predicted 588
7 SASI_Rn02_00262180 predicted 1227
8 SASI_Rn01_00076127 predicted 949
9 SASI_Rn02_00262181 predicted 368
10 SASI_Rn02_00262182 predicted 819
11 SASI_Rn01_00076125 predicted 1413
12 SASI_Rn01_00076126 predicted 1226
13 SASI_Rn01_00076128 predicted 1423
14 SASI_Rn01_00076129 predicted 910
15 SASI_Rn01_00076130 predicted 648
16 SASI_Rn01_00076131 predicted 1467
17 SASI_Rn01_00076132 predicted 1221
18 SASI_Rn01_00076133 predicted 1186
19 SASI_Rn01_00076134 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313871 predicted 1671
2 SASI_Mm02_00313872 predicted 1669
3 SASI_Mm01_00186286 predicted 1518
4 SASI_Mm01_00186287 predicted 1546
5 SASI_Mm01_00186293 predicted 1442
6 SASI_Mm02_00313873 predicted 1496
7 SASI_Mm02_00313874 predicted 1446
8 SASI_Mm02_00313875 predicted 1724
9 SASI_Mm02_00313876 predicted 1441
10 SASI_Mm02_00313877 predicted 1469
11 SASI_Mm01_00186285 predicted 1182
12 SASI_Mm01_00186288 predicted 575
13 SASI_Mm01_00186289 predicted 896
14 SASI_Mm01_00186290 predicted 671
15 SASI_Mm01_00186291 predicted 1216
16 SASI_Mm01_00186292 predicted 1217
17 SASI_Mm01_00186294 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002232
KCNA3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1897s1c1
Sequence:CCGGCGAACAATAATCCCAACTCTTCTCGAGAAGAGTTGGGATTATTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1196s1c1
Sequence:CCGGGCGAAACATCATGAACCTGATCTCGAGATCAGGTTCATGATGTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1790s1c1
Sequence:CCGGGACTCTGAGTAAGTCGGAGTACTCGAGTACTCCGACTTACTCAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-650s1c1
Sequence:CCGGGCTCCGCAACGAGTACTTCTTCTCGAGAAGAAGTACTCGTTGCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1625s1c1
Sequence:CCGGCGGTGTCTTGACCATCGCATTCTCGAGAATGCGATGGTCAAGACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002232.3-1554s21c1
Sequence:CCGGACAGTGGGTTACGGCGATATGCTCGAGCATATCGCCGTAACCCACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002232.3-2337s21c1
Sequence:CCGGGCACATCAATTCGTAGTAAATCTCGAGATTTACTACGAATTGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002232
KCNA3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1897s1c1
Sequence:CCGGCGAACAATAATCCCAACTCTTCTCGAGAAGAGTTGGGATTATTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1196s1c1
Sequence:CCGGGCGAAACATCATGAACCTGATCTCGAGATCAGGTTCATGATGTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1790s1c1
Sequence:CCGGGACTCTGAGTAAGTCGGAGTACTCGAGTACTCCGACTTACTCAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-650s1c1
Sequence:CCGGGCTCCGCAACGAGTACTTCTTCTCGAGAAGAAGTACTCGTTGCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1625s1c1
Sequence:CCGGCGGTGTCTTGACCATCGCATTCTCGAGAATGCGATGGTCAAGACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002232.3-1554s21c1
Sequence:CCGGACAGTGGGTTACGGCGATATGCTCGAGCATATCGCCGTAACCCACTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002232.3-2337s21c1
Sequence:CCGGGCACATCAATTCGTAGTAAATCTCGAGATTTACTACGAATTGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002232
KCNA3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1897s1c1
Sequence:CCGGCGAACAATAATCCCAACTCTTCTCGAGAAGAGTTGGGATTATTGTTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1196s1c1
Sequence:CCGGGCGAAACATCATGAACCTGATCTCGAGATCAGGTTCATGATGTTTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1790s1c1
Sequence:CCGGGACTCTGAGTAAGTCGGAGTACTCGAGTACTCCGACTTACTCAGAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-650s1c1
Sequence:CCGGGCTCCGCAACGAGTACTTCTTCTCGAGAAGAAGTACTCGTTGCGGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002232.2-1625s1c1
Sequence:CCGGCGGTGTCTTGACCATCGCATTCTCGAGAATGCGATGGTCAAGACACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000445607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002232.3-1554s21c1
Sequence:CCGGACAGTGGGTTACGGCGATATGCTCGAGCATATCGCCGTAACCCACTGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002232.3-2337s21c1
Sequence:CCGGGCACATCAATTCGTAGTAAATCTCGAGATTTACTACGAATTGATGTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008418
KCNA3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-1276s1c1
Sequence:CCGGGCATTGCCAGTTCCTGTGATTCTCGAGAATCACAGGAACTGGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-327s1c1
Sequence:CCGGCGACGCCATCCTCTACTACTACTCGAGTAGTAGTAGAGGATGGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-897s1c1
Sequence:CCGGGCTGGCTGAACGACAAGGTAACTCGAGTTACCTTGTCGTTCAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-1428s1c1
Sequence:CCGGTCTGAGTAAGTCGGAGTATATCTCGAGATATACTCCGACTTACTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-1260s1c1
Sequence:CCGGAGGTGTCTTGACCATTGCATTCTCGAGAATGCAATGGTCAAGACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008418
KCNA3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-1276s1c1
Sequence:CCGGGCATTGCCAGTTCCTGTGATTCTCGAGAATCACAGGAACTGGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-327s1c1
Sequence:CCGGCGACGCCATCCTCTACTACTACTCGAGTAGTAGTAGAGGATGGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-897s1c1
Sequence:CCGGGCTGGCTGAACGACAAGGTAACTCGAGTTACCTTGTCGTTCAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-1428s1c1
Sequence:CCGGTCTGAGTAAGTCGGAGTATATCTCGAGATATACTCCGACTTACTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-1260s1c1
Sequence:CCGGAGGTGTCTTGACCATTGCATTCTCGAGAATGCAATGGTCAAGACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008418
KCNA3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-1276s1c1
Sequence:CCGGGCATTGCCAGTTCCTGTGATTCTCGAGAATCACAGGAACTGGCAATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-327s1c1
Sequence:CCGGCGACGCCATCCTCTACTACTACTCGAGTAGTAGTAGAGGATGGCGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-897s1c1
Sequence:CCGGGCTGGCTGAACGACAAGGTAACTCGAGTTACCTTGTCGTTCAGCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-1428s1c1
Sequence:CCGGTCTGAGTAAGTCGGAGTATATCTCGAGATATACTCCGACTTACTCAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008418.1-1260s1c1
Sequence:CCGGAGGTGTCTTGACCATTGCATTCTCGAGAATGCAATGGTCAAGACACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???