EMAIL THIS PAGE TO A FRIEND

KCNA4

potassium voltage-gated channel, shaker-related subfamily, member 4

90 Gene Product Result for
Synonyms: HBK4 HK1 HPCN2 HUKII KCNA4L KCNA8 KV1.4 PCN2
UniProtKB ID: P22459
Gene ID:
Human(3739) Summary: Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the A-type potassium current class, the members of which may be important in the regulation of the fast repolarizing phase of action potentials in heart and thus may influence the duration of cardiac action potential.[provided by RefSeq, Mar 2011]
Mouse(16492) potassium voltage-gated channel, shaker-related subfamily, member 4
Rat(25469) potassium voltage-gated channel, shaker-related subfamily, member 4
Zebrafish(559036) potassium voltage-gated channel, shaker-related subfamily, member 4
chicken(395721) potassium voltage-gated channel, shaker-related subfamily, member 4
cow(281880) potassium voltage-gated channel, shaker-related subfamily, member 4
domestic cat(101084479) potassium voltage-gated channel, shaker-related subfamily, member 4
dog(485427) potassium voltage-gated channel, shaker-related subfamily, member 4
domestic guinea pig(100725985) potassium voltage-gated channel, shaker-related subfamily, member 4
naked mole-rat(101706863) potassium voltage-gated channel, shaker-related subfamily, member 4
sheep(101118217) potassium voltage-gated channel, shaker-related subfamily, member 4
Domestic Rabbit(100328568) potassium voltage-gated channel, shaker-related subfamily, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002233 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002233 Rosetta Predictions human pricing
NM_012971 Rosetta Predictions rat pricing
NM_021275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157976 predicted 3075
2 SASI_Hs01_00157977 predicted 2823
3 SASI_Hs01_00157979 predicted 2492
4 SASI_Hs01_00157980 predicted 2269
5 SASI_Hs01_00157981 predicted 3099
6 SASI_Hs01_00157982 predicted 2490
7 SASI_Hs01_00157983 predicted 2656
8 SASI_Hs01_00157984 predicted 1838
9 SASI_Hs02_00333467 predicted 2993
10 SASI_Hs02_00333468 predicted 2975
11 SASI_Hs01_00157978 predicted 2024
12 SASI_Hs01_00157985 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085468 predicted 2006
2 SASI_Rn01_00085469 predicted 1753
3 SASI_Rn01_00085470 predicted 1293
4 SASI_Rn01_00085471 predicted 1846
5 SASI_Rn01_00085472 predicted 1717
6 SASI_Rn01_00085473 predicted 2032
7 SASI_Rn01_00085474 predicted 700
8 SASI_Rn01_00085475 predicted 1501
9 SASI_Rn01_00085476 predicted 1423
10 SASI_Rn02_00260574 predicted 1248
11 SASI_Rn01_00085467 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052599 predicted 3121
2 SASI_Mm01_00052600 predicted 3142
3 SASI_Mm01_00052601 predicted 2204
4 SASI_Mm01_00052602 predicted 2198
5 SASI_Mm01_00052603 predicted 2836
6 SASI_Mm01_00052604 predicted 1235
7 SASI_Mm01_00052605 predicted 2702
8 SASI_Mm01_00052606 predicted 1820
9 SASI_Mm02_00325798 predicted 2956
10 SASI_Mm01_00052607 predicted 3077
11 SASI_Mm01_00052608 predicted 3206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021275
KCNA4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021275.2-4016s1c1
Sequence:CCGGCGTCTCATTTATTGTTCTCTTCTCGAGAAGAGAACAATAAATGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-2870s1c1
Sequence:CCGGCCGGTGATTGTGTCTAACTTTCTCGAGAAAGTTAGACACAATCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-2965s1c1
Sequence:CCGGCCTACCTTCTAATTTGCTCAACTCGAGTTGAGCAAATTAGAAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-2197s1c1
Sequence:CCGGCAGGGATGATAGGGACCTTATCTCGAGATAAGGTCCCTATCATCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-1757s1c1
Sequence:CCGGCGCTTCGAAACCCAAATGAAACTCGAGTTTCATTTGGGTTTCGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021275
KCNA4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021275.2-4016s1c1
Sequence:CCGGCGTCTCATTTATTGTTCTCTTCTCGAGAAGAGAACAATAAATGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-2870s1c1
Sequence:CCGGCCGGTGATTGTGTCTAACTTTCTCGAGAAAGTTAGACACAATCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-2965s1c1
Sequence:CCGGCCTACCTTCTAATTTGCTCAACTCGAGTTGAGCAAATTAGAAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-2197s1c1
Sequence:CCGGCAGGGATGATAGGGACCTTATCTCGAGATAAGGTCCCTATCATCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-1757s1c1
Sequence:CCGGCGCTTCGAAACCCAAATGAAACTCGAGTTTCATTTGGGTTTCGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021275
KCNA4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021275.2-4016s1c1
Sequence:CCGGCGTCTCATTTATTGTTCTCTTCTCGAGAAGAGAACAATAAATGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-2870s1c1
Sequence:CCGGCCGGTGATTGTGTCTAACTTTCTCGAGAAAGTTAGACACAATCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-2965s1c1
Sequence:CCGGCCTACCTTCTAATTTGCTCAACTCGAGTTGAGCAAATTAGAAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-2197s1c1
Sequence:CCGGCAGGGATGATAGGGACCTTATCTCGAGATAAGGTCCCTATCATCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021275.2-1757s1c1
Sequence:CCGGCGCTTCGAAACCCAAATGAAACTCGAGTTTCATTTGGGTTTCGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002233
KCNA4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 4
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000044146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002233.2-1660s1c1
Sequence:CCGGCGCTACAGTGACTGTTGTGAACTCGAGTTCACAACAGTCACTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002233.2-1414s1c1
Sequence:CCGGCAGCGGTCTGAGAAGAAGAAACTCGAGTTTCTTCTTCTCAGACCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002233
KCNA4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 4
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000044146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002233.2-1660s1c1
Sequence:CCGGCGCTACAGTGACTGTTGTGAACTCGAGTTCACAACAGTCACTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002233.2-1414s1c1
Sequence:CCGGCAGCGGTCTGAGAAGAAGAAACTCGAGTTTCTTCTTCTCAGACCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002233
KCNA4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 4
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000044146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002233.2-1660s1c1
Sequence:CCGGCGCTACAGTGACTGTTGTGAACTCGAGTTCACAACAGTCACTGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002233.2-1414s1c1
Sequence:CCGGCAGCGGTCTGAGAAGAAGAAACTCGAGTTTCTTCTTCTCAGACCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)