EMAIL THIS PAGE TO A FRIEND

KCNA5

potassium voltage-gated channel, shaker-related subfamily, member 5

94 Gene Product Result for
Synonyms: ATFB7 HCK1 HK2 HPCN1 KV1.5 PCN1
UniProtKB ID: P22460, Q4KKT8, Q4VAJ1, Q4VAJ2, Q9UDA4
Gene ID:
Human(3741) Summary: Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of familial atrial fibrillation type 7 (ATFB7). [provided by RefSeq, May 2012]
Mouse(16493) potassium voltage-gated channel, shaker-related subfamily, member 5
Rat(25470) potassium voltage-gated channel, shaker-related subfamily, member 5
sheep(101111448) potassium voltage-gated channel, shaker-related subfamily, member 5
Domestic Rabbit(100008684) potassium voltage-gated channel, shaker-related subfamily, member 5
domestic guinea pig(100732253) potassium voltage-gated channel, shaker-related subfamily, member 5
naked mole-rat(101715453) potassium voltage-gated channel, shaker-related subfamily, member 5
chicken(395115) potassium voltage-gated channel, shaker-related subfamily, member 5
cow(508960) potassium voltage-gated channel, shaker-related subfamily, member 5
domestic cat(101100573) potassium voltage-gated channel, shaker-related subfamily, member 5
dog(403995) potassium voltage-gated channel, shaker-related subfamily, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002234 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118431 MISSION® esiRNA esiRNA human KCNA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002234 Rosetta Predictions human pricing
NM_012972 Rosetta Predictions rat pricing
NM_145983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215027 predicted 2144
2 SASI_Hs01_00215028 predicted 1597
3 SASI_Hs01_00215029 predicted 2148
4 SASI_Hs01_00215031 predicted 2431
5 SASI_Hs01_00215032 predicted 2274
6 SASI_Hs01_00215033 predicted 1966
7 SASI_Hs01_00215034 predicted 2539
8 SASI_Hs01_00215035 predicted 2376
9 SASI_Hs02_00333469 predicted 2150
10 SASI_Hs01_00215036 predicted 2137
11 SASI_Hs01_00215030 predicted 2449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083998 predicted 1345
2 SASI_Rn01_00083999 predicted 219
3 SASI_Rn01_00084000 predicted 1220
4 SASI_Rn01_00084001 predicted 530
5 SASI_Rn01_00084004 predicted 1454
6 SASI_Rn01_00084005 predicted 1511
7 SASI_Rn01_00084006 predicted 1333
8 SASI_Rn01_00084007 predicted 1391
9 SASI_Rn02_00260575 predicted 598
10 SASI_Rn02_00260576 predicted 1447
11 SASI_Rn01_00084002 predicted 1264
12 SASI_Rn01_00084003 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028612 predicted 2114
2 SASI_Mm01_00028613 predicted 818
3 SASI_Mm01_00028614 predicted 984
4 SASI_Mm01_00028615 predicted 934
5 SASI_Mm01_00028616 predicted 1749
6 SASI_Mm01_00028617 predicted 733
7 SASI_Mm01_00028618 predicted 1896
8 SASI_Mm01_00028619 predicted 1785
9 SASI_Mm01_00028620 predicted 512
10 SASI_Mm01_00028621 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002234
KCNA5 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-935s1c1
Sequence:CCGGGTGTGGCTTATCTTCGAGTATCTCGAGATACTCGAAGATAAGCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-817s1c1
Sequence:CCGGCGCGGACGAGATACGCTTCTACTCGAGTAGAAGCGTATCTCGTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-875s1c1
Sequence:CCGGGATGAGGGCTTCATTAAAGAACTCGAGTTCTTTAATGAAGCCCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-1598s1c1
Sequence:CCGGGCTGACAACCAGGGAACCCATCTCGAGATGGGTTCCCTGGTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002234.2-2138s21c1
Sequence:CCGGACATTATACCGCAGAGTATTTCTCGAGAAATACTCTGCGGTATAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-1975s1c1
Sequence:CCGGCCTAGAGAAGTGTAACGTCAACTCGAGTTGACGTTACACTTCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002234.2-2247s21c1
Sequence:CCGGACACCCAAGGGTCGCCTATTTCTCGAGAAATAGGCGACCCTTGGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002234
KCNA5 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-935s1c1
Sequence:CCGGGTGTGGCTTATCTTCGAGTATCTCGAGATACTCGAAGATAAGCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-817s1c1
Sequence:CCGGCGCGGACGAGATACGCTTCTACTCGAGTAGAAGCGTATCTCGTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-875s1c1
Sequence:CCGGGATGAGGGCTTCATTAAAGAACTCGAGTTCTTTAATGAAGCCCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-1598s1c1
Sequence:CCGGGCTGACAACCAGGGAACCCATCTCGAGATGGGTTCCCTGGTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002234.2-2138s21c1
Sequence:CCGGACATTATACCGCAGAGTATTTCTCGAGAAATACTCTGCGGTATAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-1975s1c1
Sequence:CCGGCCTAGAGAAGTGTAACGTCAACTCGAGTTGACGTTACACTTCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002234.2-2247s21c1
Sequence:CCGGACACCCAAGGGTCGCCTATTTCTCGAGAAATAGGCGACCCTTGGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002234
KCNA5 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-935s1c1
Sequence:CCGGGTGTGGCTTATCTTCGAGTATCTCGAGATACTCGAAGATAAGCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-817s1c1
Sequence:CCGGCGCGGACGAGATACGCTTCTACTCGAGTAGAAGCGTATCTCGTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-875s1c1
Sequence:CCGGGATGAGGGCTTCATTAAAGAACTCGAGTTCTTTAATGAAGCCCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-1598s1c1
Sequence:CCGGGCTGACAACCAGGGAACCCATCTCGAGATGGGTTCCCTGGTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002234.2-2138s21c1
Sequence:CCGGACATTATACCGCAGAGTATTTCTCGAGAAATACTCTGCGGTATAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002234.2-1975s1c1
Sequence:CCGGCCTAGAGAAGTGTAACGTCAACTCGAGTTGACGTTACACTTCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002234.2-2247s21c1
Sequence:CCGGACACCCAAGGGTCGCCTATTTCTCGAGAAATAGGCGACCCTTGGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145983
KCNA5 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-1270s1c1
Sequence:CCGGGCAGAATTCTCTCGGAATATTCTCGAGAATATTCCGAGAGAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-683s1c1
Sequence:CCGGGCTACTTCGATCCCTTGAGAACTCGAGTTCTCAAGGGATCGAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-386s1c1
Sequence:CCGGCCAAAGAAACATCACCGAGGACTCGAGTCCTCGGTGATGTTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-1923s1c1
Sequence:CCGGCCTGGAGAGTACTGACAGTATCTCGAGATACTGTCAGTACTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145983.1-2359s1c1
Sequence:CCGGGCAGAGGGATAACTCAAACAACTCGAGTTGTTTGAGTTATCCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145983
KCNA5 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-1270s1c1
Sequence:CCGGGCAGAATTCTCTCGGAATATTCTCGAGAATATTCCGAGAGAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-683s1c1
Sequence:CCGGGCTACTTCGATCCCTTGAGAACTCGAGTTCTCAAGGGATCGAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-386s1c1
Sequence:CCGGCCAAAGAAACATCACCGAGGACTCGAGTCCTCGGTGATGTTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-1923s1c1
Sequence:CCGGCCTGGAGAGTACTGACAGTATCTCGAGATACTGTCAGTACTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145983.1-2359s1c1
Sequence:CCGGGCAGAGGGATAACTCAAACAACTCGAGTTGTTTGAGTTATCCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145983
KCNA5 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-1270s1c1
Sequence:CCGGGCAGAATTCTCTCGGAATATTCTCGAGAATATTCCGAGAGAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-683s1c1
Sequence:CCGGGCTACTTCGATCCCTTGAGAACTCGAGTTCTCAAGGGATCGAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-386s1c1
Sequence:CCGGCCAAAGAAACATCACCGAGGACTCGAGTCCTCGGTGATGTTTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145983.1-1923s1c1
Sequence:CCGGCCTGGAGAGTACTGACAGTATCTCGAGATACTGTCAGTACTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145983.1-2359s1c1
Sequence:CCGGGCAGAGGGATAACTCAAACAACTCGAGTTGTTTGAGTTATCCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)