EMAIL THIS PAGE TO A FRIEND

KCNA7

potassium voltage-gated channel, shaker-related subfamily, member 7

109 Gene Product Result for
Synonyms: HAK6 KV1.7
UniProtKB ID: Q96RP8, A1KYX7, Q9BYS4
Gene ID:
Human(3743) Summary: Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. The gene is expressed preferentially in skeletal muscle, heart and kidney. It is a candidate gene for inherited cardiac disorders. [provided by RefSeq, Jul 2008]
Mouse(16495) potassium voltage-gated channel, shaker-related subfamily, member 7
Rat(365241) potassium voltage-gated channel, shaker-related subfamily, member 7
sheep(101109038) potassium voltage-gated channel, shaker-related subfamily, member 7
domestic guinea pig(100726725) potassium voltage-gated channel, shaker-related subfamily, member 7
naked mole-rat(101708760) potassium voltage-gated channel, shaker-related subfamily, member 7
cow(540492) potassium voltage-gated channel, shaker-related subfamily, member 7
dog(100855855) potassium voltage-gated channel, shaker-related subfamily, member 7
domestic cat(101083818) potassium voltage-gated channel, shaker-related subfamily, member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031886 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040831 MISSION® esiRNA esiRNA human KCNA7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031886 Rosetta Predictions human pricing
NM_001108914 Rosetta Predictions rat pricing
NM_010596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031389 predicted 1339
2 SASI_Hs01_00031390 predicted 921
3 SASI_Hs01_00031391 predicted 1099
4 SASI_Hs01_00031392 predicted 1232
5 SASI_Hs01_00031393 predicted 2212
6 SASI_Hs01_00031394 predicted 1390
7 SASI_Hs01_00031395 predicted 1234
8 SASI_Hs01_00031396 predicted 2144
9 SASI_Hs02_00358993 predicted 1452
10 SASI_Hs01_00031397 predicted 1045
11 SASI_Hs01_00031398 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243334 predicted 1740
2 SASI_Rn02_00243335 predicted 730
3 SASI_Rn02_00243336 predicted 1961
4 SASI_Rn02_00243337 predicted 1337
5 SASI_Rn02_00243338 predicted 2037
6 SASI_Rn02_00243339 predicted 2119
7 SASI_Rn02_00243340 predicted 1998
8 SASI_Rn02_00243341 predicted 1987
9 SASI_Rn02_00243342 predicted 1992
10 SASI_Rn02_00243343 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151559 predicted 1673
2 SASI_Mm02_00318907 predicted 2192
3 SASI_Mm01_00151560 predicted 1679
4 SASI_Mm02_00318908 predicted 1844
5 SASI_Mm01_00151563 predicted 1679
6 SASI_Mm01_00151564 predicted 2102
7 SASI_Mm01_00151565 predicted 1386
8 SASI_Mm01_00151566 predicted 1109
9 SASI_Mm02_00318909 predicted 2199
10 SASI_Mm01_00151567 predicted 1109
11 SASI_Mm01_00151561 predicted 279
12 SASI_Mm01_00151562 predicted 1665
13 SASI_Mm01_00151568 predicted 1929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031886
KCNA7 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1341s1c1
Sequence:CCGGGCCGTCTACTTTGCCGAAGTTCTCGAGAACTTCGGCAAAGTAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-965s1c1
Sequence:CCGGGCCCTTCAATGACCCGTTCTTCTCGAGAAGAACGGGTCATTGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1235s1c1
Sequence:CCGGGCACTCAAAGGGCCTGCAAATCTCGAGATTTGCAGGCCCTTTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031886.2-1957s21c1
Sequence:CCGGGACTCAATTGGTTCATATTACCTCGAGGTAATATGAACCAATTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1055s1c1
Sequence:CCGGCAAGGCTATCTTCTTCAAGAACTCGAGTTCTTGAAGAAGATAGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1076s1c1
Sequence:CCGGCGTGATGAACCTCATCGATTTCTCGAGAAATCGATGAGGTTCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031886.2-1817s21c1
Sequence:CCGGGTTTAGGAAGAGCTAGGTTAACTCGAGTTAACCTAGCTCTTCCTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031886
KCNA7 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1341s1c1
Sequence:CCGGGCCGTCTACTTTGCCGAAGTTCTCGAGAACTTCGGCAAAGTAGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-965s1c1
Sequence:CCGGGCCCTTCAATGACCCGTTCTTCTCGAGAAGAACGGGTCATTGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1235s1c1
Sequence:CCGGGCACTCAAAGGGCCTGCAAATCTCGAGATTTGCAGGCCCTTTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031886.2-1957s21c1
Sequence:CCGGGACTCAATTGGTTCATATTACCTCGAGGTAATATGAACCAATTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1055s1c1
Sequence:CCGGCAAGGCTATCTTCTTCAAGAACTCGAGTTCTTGAAGAAGATAGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1076s1c1
Sequence:CCGGCGTGATGAACCTCATCGATTTCTCGAGAAATCGATGAGGTTCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031886.2-1817s21c1
Sequence:CCGGGTTTAGGAAGAGCTAGGTTAACTCGAGTTAACCTAGCTCTTCCTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031886
KCNA7 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1341s1c1
Sequence:CCGGGCCGTCTACTTTGCCGAAGTTCTCGAGAACTTCGGCAAAGTAGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-965s1c1
Sequence:CCGGGCCCTTCAATGACCCGTTCTTCTCGAGAAGAACGGGTCATTGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1235s1c1
Sequence:CCGGGCACTCAAAGGGCCTGCAAATCTCGAGATTTGCAGGCCCTTTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031886.2-1957s21c1
Sequence:CCGGGACTCAATTGGTTCATATTACCTCGAGGTAATATGAACCAATTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1055s1c1
Sequence:CCGGCAAGGCTATCTTCTTCAAGAACTCGAGTTCTTGAAGAAGATAGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031886.2-1076s1c1
Sequence:CCGGCGTGATGAACCTCATCGATTTCTCGAGAAATCGATGAGGTTCATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031886.2-1817s21c1
Sequence:CCGGGTTTAGGAAGAGCTAGGTTAACTCGAGTTAACCTAGCTCTTCCTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010596
KCNA7 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1099s1c1
Sequence:CCGGCCCTTCAACGATCCATTCTTTCTCGAGAAAGAATGGATCGTTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1182s1c1
Sequence:CCGGCCCTAGCAAAGCTGTGTTCTTCTCGAGAAGAACACAGCTTTGCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1218s1c1
Sequence:CCGGCCTAATTGACTTCGTGGCCATCTCGAGATGGCCACGAAGTCAATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-389s1c1
Sequence:CCGGGCCGGACTTTCCATGCTATTTCTCGAGAAATAGCATGGAAAGTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1669s1c1
Sequence:CCGGGTCTCTAACTTTAGCTACTTTCTCGAGAAAGTAGCTAAAGTTAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010596
KCNA7 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1099s1c1
Sequence:CCGGCCCTTCAACGATCCATTCTTTCTCGAGAAAGAATGGATCGTTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1182s1c1
Sequence:CCGGCCCTAGCAAAGCTGTGTTCTTCTCGAGAAGAACACAGCTTTGCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1218s1c1
Sequence:CCGGCCTAATTGACTTCGTGGCCATCTCGAGATGGCCACGAAGTCAATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-389s1c1
Sequence:CCGGGCCGGACTTTCCATGCTATTTCTCGAGAAATAGCATGGAAAGTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1669s1c1
Sequence:CCGGGTCTCTAACTTTAGCTACTTTCTCGAGAAAGTAGCTAAAGTTAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010596
KCNA7 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1099s1c1
Sequence:CCGGCCCTTCAACGATCCATTCTTTCTCGAGAAAGAATGGATCGTTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1182s1c1
Sequence:CCGGCCCTAGCAAAGCTGTGTTCTTCTCGAGAAGAACACAGCTTTGCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1218s1c1
Sequence:CCGGCCTAATTGACTTCGTGGCCATCTCGAGATGGCCACGAAGTCAATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-389s1c1
Sequence:CCGGGCCGGACTTTCCATGCTATTTCTCGAGAAATAGCATGGAAAGTCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010596.1-1669s1c1
Sequence:CCGGGTCTCTAACTTTAGCTACTTTCTCGAGAAAGTAGCTAAAGTTAGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)