EMAIL THIS PAGE TO A FRIEND

KCNAB1

potassium voltage-gated channel, shaker-related subfamily, beta member 1

155 Gene Product Result for
Synonyms: AKR6A3 KCNA1B KV-BETA-1 Kvb1.3 hKvBeta3 hKvb3
Gene ID:
Human(7881) Summary: Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes three distinct isoforms which are encoded by three alternatively spliced transcript variants of this gene. These three isoforms are beta subunits, which form heteromultimeric complex with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Jul 2008]
Mouse(16497) potassium voltage-gated channel, shaker-related subfamily, beta member 1
Rat(29737) potassium voltage-gated channel, shaker-related subfamily, beta member 1
Zebrafish(541540) potassium voltage-gated channel, shaker-related subfamily, beta member 1
domestic cat(101086170) potassium voltage-gated channel, shaker-related subfamily, beta member 1
cow(526133) potassium voltage-gated channel, shaker-related subfamily, beta member 1
Horse(100050434) potassium voltage-gated channel, shaker-related subfamily, beta member 1
dog(612006) potassium voltage-gated channel, shaker-related subfamily, beta member 1
chicken(395730) potassium voltage-gated channel, shaker-related subfamily, beta member 1
domestic guinea pig(100725410) potassium voltage-gated channel, shaker-related subfamily, beta member 1
naked mole-rat(101720455) potassium voltage-gated channel, shaker-related subfamily, beta member 1
sheep(101110988) potassium voltage-gated channel, shaker-related subfamily, beta member 1
Domestic Rabbit(100328569) potassium voltage-gated channel, shaker-related subfamily, beta member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35126 Anti-KCNAB1 antibody produced in rabbit affinity isolated antibody rabbit, rabbit, canine, horse, pig, rat, zebrafish, bovine, mouse, human, guinea pig
immunohistochemistry, western blot pricing
HPA044550 Anti-KCNAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5200057 Monoclonal Anti-KCNAB1 antibody produced in mouse clone S9-40, 1 mg/mL, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200066 Monoclonal Anti-KCNAB1 antibody produced in mouse clone S40-17, 1 mg/mL, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003471 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003471 Rosetta Predictions human pricing
NM_172159 Rosetta Predictions human pricing
NM_172160 Rosetta Predictions human pricing
NM_017303 Rosetta Predictions rat pricing
NM_010597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157341 predicted 821
2 SASI_Hs02_00335728 predicted 725
3 SASI_Hs01_00157345 predicted 909
4 SASI_Hs02_00335729 predicted 837
5 SASI_Hs02_00335730 predicted 1371
6 SASI_Hs01_00157346 predicted 1110
7 SASI_Hs01_00157347 predicted 1361
8 SASI_Hs01_00157348 predicted 741
9 SASI_Hs01_00157349 predicted 919
10 SASI_Hs01_00157350 predicted 939
11 SASI_Hs01_00157342 predicted 1411
12 SASI_Hs01_00157343 predicted 730
13 SASI_Hs01_00157344 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183612 predicted 1498
2 SASI_Hs02_00367852 predicted 1412
3 SASI_Hs01_00183616 predicted 1594
4 SASI_Hs02_00367853 predicted 1523
5 SASI_Hs02_00367854 predicted 2061
6 SASI_Hs01_00183617 predicted 1799
7 SASI_Hs01_00183618 predicted 2052
8 SASI_Hs01_00183619 predicted 1417
9 SASI_Hs01_00183620 predicted 1598
10 SASI_Hs01_00183621 predicted 1621
11 SASI_Hs01_00183613 predicted 2043
12 SASI_Hs01_00183614 predicted 1361
13 SASI_Hs01_00183615 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037859 predicted 697
2 SASI_Hs02_00367855 predicted 605
3 SASI_Hs01_00037863 predicted 788
4 SASI_Hs02_00367856 predicted 712
5 SASI_Hs02_00367857 predicted 1251
6 SASI_Hs01_00037864 predicted 996
7 SASI_Hs01_00037865 predicted 1241
8 SASI_Hs01_00037866 predicted 615
9 SASI_Hs01_00037867 predicted 799
10 SASI_Hs01_00037868 predicted 818
11 SASI_Hs01_00037860 predicted 1274
12 SASI_Hs01_00037861 predicted 601
13 SASI_Hs01_00037862 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091977 predicted 1787
2 SASI_Rn01_00091978 predicted 850
3 SASI_Rn01_00091980 predicted 1795
4 SASI_Rn01_00091981 predicted 901
5 SASI_Rn01_00091982 predicted 1529
6 SASI_Rn01_00091983 predicted 1540
7 SASI_Rn02_00261748 predicted 1655
8 SASI_Rn01_00091984 predicted 1490
9 SASI_Rn01_00091985 predicted 1171
10 SASI_Rn01_00091986 predicted 1617
11 SASI_Rn01_00091979 predicted 1139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318910 predicted 612
2 SASI_Mm01_00090959 predicted 300
3 SASI_Mm02_00318911 predicted 369
4 SASI_Mm01_00090961 predicted 1258
5 SASI_Mm01_00090962 predicted 1007
6 SASI_Mm01_00090963 predicted 1010
7 SASI_Mm01_00090964 predicted 395
8 SASI_Mm01_00090965 predicted 317
9 SASI_Mm02_00318912 predicted 1332
10 SASI_Mm02_00318913 predicted 356
11 SASI_Mm01_00090956 predicted 888
12 SASI_Mm01_00090957 predicted 732
13 SASI_Mm01_00090958 predicted 885
14 SASI_Mm01_00090960 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010597
KCNAB1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, beta member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010597.2-2794s1c1
Sequence:CCGGGCTATCTGTAAATACGGATAACTCGAGTTATCCGTATTTACAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-415s1c1
Sequence:CCGGGCACAATTTGAAGAGTCGAAACTCGAGTTTCGACTCTTCAAATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-1300s1c1
Sequence:CCGGCCAGTGGTTGAAGGAAAGAATCTCGAGATTCTTTCCTTCAACCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-1528s1c1
Sequence:CCGGCGTGGTGAACGAGATTGATAACTCGAGTTATCAATCTCGTTCACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-881s1c1
Sequence:CCGGCTGTCAAGAAAGCATATCATTCTCGAGAATGATATGCTTTCTTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010597
KCNAB1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, beta member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010597.2-2794s1c1
Sequence:CCGGGCTATCTGTAAATACGGATAACTCGAGTTATCCGTATTTACAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-415s1c1
Sequence:CCGGGCACAATTTGAAGAGTCGAAACTCGAGTTTCGACTCTTCAAATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-1300s1c1
Sequence:CCGGCCAGTGGTTGAAGGAAAGAATCTCGAGATTCTTTCCTTCAACCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-1528s1c1
Sequence:CCGGCGTGGTGAACGAGATTGATAACTCGAGTTATCAATCTCGTTCACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-881s1c1
Sequence:CCGGCTGTCAAGAAAGCATATCATTCTCGAGAATGATATGCTTTCTTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010597
KCNAB1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, beta member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010597.2-2794s1c1
Sequence:CCGGGCTATCTGTAAATACGGATAACTCGAGTTATCCGTATTTACAGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-415s1c1
Sequence:CCGGGCACAATTTGAAGAGTCGAAACTCGAGTTTCGACTCTTCAAATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-1300s1c1
Sequence:CCGGCCAGTGGTTGAAGGAAAGAATCTCGAGATTCTTTCCTTCAACCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-1528s1c1
Sequence:CCGGCGTGGTGAACGAGATTGATAACTCGAGTTATCAATCTCGTTCACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010597.2-881s1c1
Sequence:CCGGCTGTCAAGAAAGCATATCATTCTCGAGAATGATATGCTTTCTTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003471
KCNAB1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, beta member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-565s1c1
Sequence:CCGGCGCCTATGAAAGTGGTGTTAACTCGAGTTAACACCACTTTCATAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-372s1c1
Sequence:CCGGCCGAACAGAAATATGTGGAAACTCGAGTTTCCACATATTTCTGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-1150s1c1
Sequence:CCGGCCAGTGGTTGAAAGAAAGAATCTCGAGATTCTTTCTTTCAACCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-1317s1c1
Sequence:CCGGCTCCTGAACAACTCATTGAAACTCGAGTTTCAATGAGTTGTTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-730s1c1
Sequence:CCGGGCTGTCAAGAAAGCATATTATCTCGAGATAATATGCTTTCTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003471
KCNAB1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, beta member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-565s1c1
Sequence:CCGGCGCCTATGAAAGTGGTGTTAACTCGAGTTAACACCACTTTCATAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-372s1c1
Sequence:CCGGCCGAACAGAAATATGTGGAAACTCGAGTTTCCACATATTTCTGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-1150s1c1
Sequence:CCGGCCAGTGGTTGAAAGAAAGAATCTCGAGATTCTTTCTTTCAACCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-1317s1c1
Sequence:CCGGCTCCTGAACAACTCATTGAAACTCGAGTTTCAATGAGTTGTTCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-730s1c1
Sequence:CCGGGCTGTCAAGAAAGCATATTATCTCGAGATAATATGCTTTCTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003471
KCNAB1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, beta member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-565s1c1
Sequence:CCGGCGCCTATGAAAGTGGTGTTAACTCGAGTTAACACCACTTTCATAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-372s1c1
Sequence:CCGGCCGAACAGAAATATGTGGAAACTCGAGTTTCCACATATTTCTGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-1150s1c1
Sequence:CCGGCCAGTGGTTGAAAGAAAGAATCTCGAGATTCTTTCTTTCAACCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-1317s1c1
Sequence:CCGGCTCCTGAACAACTCATTGAAACTCGAGTTTCAATGAGTTGTTCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003471.2-730s1c1
Sequence:CCGGGCTGTCAAGAAAGCATATTATCTCGAGATAATATGCTTTCTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)