EMAIL THIS PAGE TO A FRIEND

KCNAB2

potassium voltage-gated channel, shaker-related subfamily, beta member 2

94 Gene Product Result for
Synonyms: AKR6A5 HKvbeta2 HKvbeta2.1 HKvbeta2.2 KCNA2B KV-BETA-2
Gene ID:
Human(8514) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. This member alters functional properties of the KCNA4 gene product. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2010]
Mouse(16498) potassium voltage-gated channel, shaker-related subfamily, beta member 2
Rat(29738) potassium voltage-gated channel, shaker-related subfamily, beta member 2
Zebrafish(797337) potassium voltage-gated channel, shaker-related subfamily, beta member 2
dog(489626) potassium voltage-gated channel, shaker-related subfamily, beta member 2
domestic cat(101089372) potassium voltage-gated channel, shaker-related subfamily, beta member 2
cow(541597) potassium voltage-gated channel, shaker-related subfamily, beta member 2
chicken(396068) potassium voltage-gated channel, shaker-related subfamily, beta member 2
sheep(101122538) potassium voltage-gated channel, shaker-related subfamily, beta member 2
Domestic Rabbit(100328600) potassium voltage-gated channel, shaker-related subfamily, beta member 2
domestic guinea pig(100726297) potassium voltage-gated channel, shaker-related subfamily, beta member 2
naked mole-rat(101710049) potassium voltage-gated channel, shaker-related subfamily, beta member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV37678 Anti-KCNAB2 (AB1) antibody produced in rabbit affinity isolated antibody mouse, bovine, rat, horse, guinea pig, rabbit, human, dog
immunohistochemistry, western blot pricing
AV35461 Anti-KCNAB2 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, dog, rat, bovine, horse, human, rabbit, guinea pig
western blot pricing
SAB2101202 Anti-KCNAB2 antibody produced in rabbit affinity isolated antibody human, rabbit, mouse, dog, guinea pig, rat, bovine, horse
immunohistochemistry, western blot pricing
HPA030185 Anti-KCNAB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106414 Anti-KCNAB2 antibody produced in rabbit affinity isolated antibody dog, guinea pig, rabbit, bovine, human, rat, mouse, horse
immunohistochemistry, western blot pricing
K4889 Anti-Potassium Channel KVβ2 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat, mouse
immunohistochemistry, western blot pricing
SAB5200060 Monoclonal Anti-KCNAB2 antibody produced in mouse clone S17-70, 1 mg/mL, purified immunoglobulin rat, mouse, zebrafish, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003636 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003636 Rosetta Predictions human pricing
NM_172130 Rosetta Predictions human pricing
NM_017304 Rosetta Predictions rat pricing
NM_010598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017605 predicted 1358
2 SASI_Hs01_00017606 predicted 1176
3 SASI_Hs01_00017607 predicted 1194
4 SASI_Hs01_00017608 predicted 822
5 SASI_Hs01_00017609 predicted 1394
6 SASI_Hs01_00017610 predicted 507
7 SASI_Hs01_00017611 predicted 762
8 SASI_Hs01_00017612 predicted 1444
9 SASI_Hs02_00335990 predicted 839
10 SASI_Hs01_00017613 predicted 1497
11 SASI_Hs01_00017604 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203902 predicted 1322
2 SASI_Hs01_00203903 predicted 1132
3 SASI_Hs01_00203904 predicted 1153
4 SASI_Hs01_00203905 predicted 784
5 SASI_Hs01_00203906 predicted 1353
6 SASI_Hs01_00203907 predicted 463
7 SASI_Hs01_00203908 predicted 726
8 SASI_Hs01_00203909 predicted 1406
9 SASI_Hs02_00367848 predicted 796
10 SASI_Hs01_00203910 predicted 1454
11 SASI_Hs01_00203901 predicted 1499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087336 predicted 1108
2 SASI_Rn01_00087337 predicted 923
3 SASI_Rn01_00087338 predicted 1167
4 SASI_Rn01_00087339 predicted 692
5 SASI_Rn01_00087340 predicted 559
6 SASI_Rn01_00087341 predicted 1121
7 SASI_Rn01_00087342 predicted 1066
8 SASI_Rn01_00087343 predicted 653
9 SASI_Rn01_00087344 predicted 761
10 SASI_Rn01_00087345 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055433 predicted 425
2 SASI_Mm01_00055434 predicted 777
3 SASI_Mm01_00055435 predicted 214
4 SASI_Mm02_00318914 predicted 524
5 SASI_Mm02_00318915 predicted 1201
6 SASI_Mm01_00055436 predicted 1223
7 SASI_Mm01_00055439 predicted 413
8 SASI_Mm01_00055440 predicted 1379
9 SASI_Mm01_00055441 predicted 343
10 SASI_Mm01_00055442 predicted 1162
11 SASI_Mm01_00055437 predicted 541
12 SASI_Mm01_00055438 predicted 1137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010598
VALIDATED
KCNAB2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, beta member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010598.2-1188s1c1
Sequence:CCGGCGACAGCATTCTGGGCAATAACTCGAGTTATTGCCCAGAATGCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-2270s1c1
Sequence:CCGGGCCCTTTATCACTGGGATAAACTCGAGTTTATCCCAGTGATAAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-774s1c1
Sequence:CCGGGCAAGCGGAATATCACATGTTCTCGAGAACATGTGATATTCCGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-471s1c1
Sequence:CCGGCCTTGTCATCACCACCAAGATCTCGAGATCTTGGTGGTGATGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-823s1c1
Sequence:CCGGCCAGAGCTGTTCCACAAGATACTCGAGTATCTTGTGGAACAGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010598.2-881s21c1
Sequence:CCGGGCATCGTCTCAGGGAAGTATGCTCGAGCATACTTCCCTGAGACGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010598.2-425s21c1
Sequence:CCGGTGGTATTAGGGAACATCATTACTCGAGTAATGATGTTCCCTAATACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010598.2-1546s21c1
Sequence:CCGGCCATGGCCCTTCACGGAAATTCTCGAGAATTTCCGTGAAGGGCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010598
VALIDATED
KCNAB2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, beta member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010598.2-1188s1c1
Sequence:CCGGCGACAGCATTCTGGGCAATAACTCGAGTTATTGCCCAGAATGCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-2270s1c1
Sequence:CCGGGCCCTTTATCACTGGGATAAACTCGAGTTTATCCCAGTGATAAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-774s1c1
Sequence:CCGGGCAAGCGGAATATCACATGTTCTCGAGAACATGTGATATTCCGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-471s1c1
Sequence:CCGGCCTTGTCATCACCACCAAGATCTCGAGATCTTGGTGGTGATGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-823s1c1
Sequence:CCGGCCAGAGCTGTTCCACAAGATACTCGAGTATCTTGTGGAACAGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010598.2-881s21c1
Sequence:CCGGGCATCGTCTCAGGGAAGTATGCTCGAGCATACTTCCCTGAGACGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010598.2-425s21c1
Sequence:CCGGTGGTATTAGGGAACATCATTACTCGAGTAATGATGTTCCCTAATACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010598.2-1546s21c1
Sequence:CCGGCCATGGCCCTTCACGGAAATTCTCGAGAATTTCCGTGAAGGGCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010598
VALIDATED
KCNAB2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, beta member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010598.2-1188s1c1
Sequence:CCGGCGACAGCATTCTGGGCAATAACTCGAGTTATTGCCCAGAATGCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-2270s1c1
Sequence:CCGGGCCCTTTATCACTGGGATAAACTCGAGTTTATCCCAGTGATAAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-774s1c1
Sequence:CCGGGCAAGCGGAATATCACATGTTCTCGAGAACATGTGATATTCCGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-471s1c1
Sequence:CCGGCCTTGTCATCACCACCAAGATCTCGAGATCTTGGTGGTGATGACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010598.2-823s1c1
Sequence:CCGGCCAGAGCTGTTCCACAAGATACTCGAGTATCTTGTGGAACAGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010598.2-881s21c1
Sequence:CCGGGCATCGTCTCAGGGAAGTATGCTCGAGCATACTTCCCTGAGACGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010598.2-425s21c1
Sequence:CCGGTGGTATTAGGGAACATCATTACTCGAGTAATGATGTTCCCTAATACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010598.2-1546s21c1
Sequence:CCGGCCATGGCCCTTCACGGAAATTCTCGAGAATTTCCGTGAAGGGCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003636
KCNAB2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, beta member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-1200s1c1
Sequence:CCGGCGAAACTGTCATCTTCCATTACTCGAGTAATGGAAGATGACAGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-1221s1c1
Sequence:CCGGTCCACGAGATTGATAGTATTTCTCGAGAAATACTATCAATCTCGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-568s1c1
Sequence:CCGGCCTGTCCAGGAAGCACATAATCTCGAGATTATGTGCTTCCTGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-1184s1c1
Sequence:CCGGGCAATACAGGTCCTTCCGAAACTCGAGTTTCGGAAGGACCTGTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-514s1c1
Sequence:CCGGCCTCGTCATCACCACCAAGATCTCGAGATCTTGGTGGTGATGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003636
KCNAB2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, beta member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-1200s1c1
Sequence:CCGGCGAAACTGTCATCTTCCATTACTCGAGTAATGGAAGATGACAGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-1221s1c1
Sequence:CCGGTCCACGAGATTGATAGTATTTCTCGAGAAATACTATCAATCTCGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-568s1c1
Sequence:CCGGCCTGTCCAGGAAGCACATAATCTCGAGATTATGTGCTTCCTGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-1184s1c1
Sequence:CCGGGCAATACAGGTCCTTCCGAAACTCGAGTTTCGGAAGGACCTGTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-514s1c1
Sequence:CCGGCCTCGTCATCACCACCAAGATCTCGAGATCTTGGTGGTGATGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003636
KCNAB2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, beta member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-1200s1c1
Sequence:CCGGCGAAACTGTCATCTTCCATTACTCGAGTAATGGAAGATGACAGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-1221s1c1
Sequence:CCGGTCCACGAGATTGATAGTATTTCTCGAGAAATACTATCAATCTCGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-568s1c1
Sequence:CCGGCCTGTCCAGGAAGCACATAATCTCGAGATTATGTGCTTCCTGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-1184s1c1
Sequence:CCGGGCAATACAGGTCCTTCCGAAACTCGAGTTTCGGAAGGACCTGTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003636.2-514s1c1
Sequence:CCGGCCTCGTCATCACCACCAAGATCTCGAGATCTTGGTGGTGATGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)