EMAIL THIS PAGE TO A FRIEND

KCNAB3

potassium voltage-gated channel, shaker-related subfamily, beta member 3

72 Gene Product Result for
Synonyms: AKR6A9 KCNA3.1B KCNA3B KV-BETA-3
UniProtKB ID: O43448, Q4VAW0
Gene ID:
Human(9196) Summary: This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. The encoded protein is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. The encoded protein forms a heterodimer with the potassium voltage-gated channel, shaker-related subfamily, member 5 gene product and regulates the activity of the alpha subunit. [provided by RefSeq, May 2012]
Mouse(16499) potassium voltage-gated channel, shaker-related subfamily, beta member 3
Rat(58981) potassium voltage-gated channel, shaker-related subfamily, beta member 3
domestic guinea pig(100733306) potassium voltage-gated channel, shaker-related subfamily, beta member 3
naked mole-rat(101705448) potassium voltage-gated channel, shaker-related subfamily, beta member 3
sheep(101120425) potassium voltage-gated channel, shaker-related subfamily, beta member 3
Domestic Rabbit(100347523) potassium voltage-gated channel, shaker-related subfamily, beta member 3
domestic cat(101100762) potassium voltage-gated channel, shaker-related subfamily, beta member 3
cow(789104) potassium voltage-gated channel, shaker-related subfamily, beta member 3
Horse(100062213) potassium voltage-gated channel, shaker-related subfamily, beta member 3
dog(489483) potassium voltage-gated channel, shaker-related subfamily, beta member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35151 Anti-KCNAB3 antibody produced in rabbit IgG fraction of antiserum rat, horse, canine, human, bovine, rabbit, guinea pig, mouse
immunohistochemistry, western blot pricing
SAB4503582 Anti-KCNAB3 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
HPA077993 Anti-KCNAB3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004732 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004732 Rosetta Predictions human pricing
NM_031652 Rosetta Predictions rat pricing
NM_010599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034774 predicted 1183
2 SASI_Hs01_00034775 predicted 352
3 SASI_Hs01_00034776 predicted 501
4 SASI_Hs01_00034777 predicted 867
5 SASI_Hs01_00034778 predicted 496
6 SASI_Hs01_00034779 predicted 402
7 SASI_Hs01_00034780 predicted 452
8 SASI_Hs01_00034781 predicted 939
9 SASI_Hs01_00034782 predicted 286
10 SASI_Hs01_00034783 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043397 predicted 843
2 SASI_Rn01_00043398 predicted 790
3 SASI_Rn01_00043399 predicted 735
4 SASI_Rn01_00043400 predicted 711
5 SASI_Rn01_00043401 predicted 955
6 SASI_Rn01_00043402 predicted 741
7 SASI_Rn01_00043403 predicted 1265
8 SASI_Rn02_00264986 predicted 690
9 SASI_Rn01_00043404 predicted 1629
10 SASI_Rn01_00043405 predicted 875
11 SASI_Rn01_00043406 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041014 predicted 1661
2 SASI_Mm01_00041015 predicted 1016
3 SASI_Mm01_00041016 predicted 1119
4 SASI_Mm01_00041017 predicted 732
5 SASI_Mm01_00041018 predicted 750
6 SASI_Mm01_00041020 predicted 1026
7 SASI_Mm01_00041021 predicted 997
8 SASI_Mm01_00041022 predicted 1303
9 SASI_Mm01_00041023 predicted 806
10 SASI_Mm02_00318916 predicted 1193
11 SASI_Mm01_00041019 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004732
KCNAB3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, beta member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004732.2-219s21c1
Sequence:CCGGCCGAGGCACTGGCATGAAATACTCGAGTATTTCATGCCAGTGCCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004732.2-1360s21c1
Sequence:CCGGTAGTGATACGCATGAACAAAGCTCGAGCTTTGTTCATGCGTATCACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004732.2-1099s21c1
Sequence:CCGGAGTGCGGAGCAGTTGATAGAACTCGAGTTCTATCAACTGCTCCGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-727s1c1
Sequence:CCGGGCCAGACAGTTCAATCTGATTCTCGAGAATCAGATTGAACTGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-1194s1c1
Sequence:CCGGCAAGCCGCATTCCAAGAAGTACTCGAGTACTTCTTGGAATGCGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-452s1c1
Sequence:CCGGGATCAAGCTATGTCATCACTACTCGAGTAGTGATGACATAGCTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-774s1c1
Sequence:CCGGCCATCTGTTTCAGAGGGAGAACTCGAGTTCTCCCTCTGAAACAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-346s1c1
Sequence:CCGGGTAGCCTATGAGCATGGTGTACTCGAGTACACCATGCTCATAGGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004732
KCNAB3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, beta member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004732.2-219s21c1
Sequence:CCGGCCGAGGCACTGGCATGAAATACTCGAGTATTTCATGCCAGTGCCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004732.2-1360s21c1
Sequence:CCGGTAGTGATACGCATGAACAAAGCTCGAGCTTTGTTCATGCGTATCACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004732.2-1099s21c1
Sequence:CCGGAGTGCGGAGCAGTTGATAGAACTCGAGTTCTATCAACTGCTCCGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-727s1c1
Sequence:CCGGGCCAGACAGTTCAATCTGATTCTCGAGAATCAGATTGAACTGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-1194s1c1
Sequence:CCGGCAAGCCGCATTCCAAGAAGTACTCGAGTACTTCTTGGAATGCGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-452s1c1
Sequence:CCGGGATCAAGCTATGTCATCACTACTCGAGTAGTGATGACATAGCTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-774s1c1
Sequence:CCGGCCATCTGTTTCAGAGGGAGAACTCGAGTTCTCCCTCTGAAACAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-346s1c1
Sequence:CCGGGTAGCCTATGAGCATGGTGTACTCGAGTACACCATGCTCATAGGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004732
KCNAB3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, beta member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004732.2-219s21c1
Sequence:CCGGCCGAGGCACTGGCATGAAATACTCGAGTATTTCATGCCAGTGCCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004732.2-1360s21c1
Sequence:CCGGTAGTGATACGCATGAACAAAGCTCGAGCTTTGTTCATGCGTATCACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004732.2-1099s21c1
Sequence:CCGGAGTGCGGAGCAGTTGATAGAACTCGAGTTCTATCAACTGCTCCGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-727s1c1
Sequence:CCGGGCCAGACAGTTCAATCTGATTCTCGAGAATCAGATTGAACTGTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-1194s1c1
Sequence:CCGGCAAGCCGCATTCCAAGAAGTACTCGAGTACTTCTTGGAATGCGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-452s1c1
Sequence:CCGGGATCAAGCTATGTCATCACTACTCGAGTAGTGATGACATAGCTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-774s1c1
Sequence:CCGGCCATCTGTTTCAGAGGGAGAACTCGAGTTCTCCCTCTGAAACAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004732.2-346s1c1
Sequence:CCGGGTAGCCTATGAGCATGGTGTACTCGAGTACACCATGCTCATAGGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010599
KCNAB3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, beta member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1292s1c1
Sequence:CCGGCGGCCTCATTACTAGCAAGTACTCGAGTACTTGCTAGTAATGAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1018s1c1
Sequence:CCGGCCAATCGTTCAGATCCTAATACTCGAGTATTAGGATCTGAACGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-989s1c1
Sequence:CCGGCCAGCTGGAATACGTTGATATCTCGAGATATCAACGTATTCCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1188s1c1
Sequence:CCGGCAAGCGGAGAACCACTTCTTTCTCGAGAAAGAAGTGGTTCTCCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1619s1c1
Sequence:CCGGCAAATCGCATTCCAAGAAGTACTCGAGTACTTCTTGGAATGCGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010599
KCNAB3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, beta member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1292s1c1
Sequence:CCGGCGGCCTCATTACTAGCAAGTACTCGAGTACTTGCTAGTAATGAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1018s1c1
Sequence:CCGGCCAATCGTTCAGATCCTAATACTCGAGTATTAGGATCTGAACGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-989s1c1
Sequence:CCGGCCAGCTGGAATACGTTGATATCTCGAGATATCAACGTATTCCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1188s1c1
Sequence:CCGGCAAGCGGAGAACCACTTCTTTCTCGAGAAAGAAGTGGTTCTCCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1619s1c1
Sequence:CCGGCAAATCGCATTCCAAGAAGTACTCGAGTACTTCTTGGAATGCGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010599
KCNAB3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, beta member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1292s1c1
Sequence:CCGGCGGCCTCATTACTAGCAAGTACTCGAGTACTTGCTAGTAATGAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1018s1c1
Sequence:CCGGCCAATCGTTCAGATCCTAATACTCGAGTATTAGGATCTGAACGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-989s1c1
Sequence:CCGGCCAGCTGGAATACGTTGATATCTCGAGATATCAACGTATTCCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1188s1c1
Sequence:CCGGCAAGCGGAGAACCACTTCTTTCTCGAGAAAGAAGTGGTTCTCCGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010599.2-1619s1c1
Sequence:CCGGCAAATCGCATTCCAAGAAGTACTCGAGTACTTCTTGGAATGCGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)