EMAIL THIS PAGE TO A FRIEND

KCNB1

potassium voltage-gated channel, Shab-related subfamily, member 1

99 Gene Product Result for
Synonyms: DRK1 KV2.1 h-DRK1
UniProtKB ID: Q14721, Q14193
Gene ID:
Human(3745) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel and its activity is modulated by some other family members. [provided by RefSeq, Jul 2008]
Mouse(16500) potassium voltage gated channel, Shab-related subfamily, member 1
Rat(25736) potassium voltage gated channel, Shab-related subfamily, member 1
Zebrafish(555284) potassium voltage-gated channel, Shab-related subfamily, member 1
cow(539528) potassium voltage-gated channel, Shab-related subfamily, member 1
Horse(100057009) potassium voltage-gated channel, Shab-related subfamily, member 1
domestic cat(101101556) potassium voltage-gated channel, Shab-related subfamily, member 1
dog(485918) potassium voltage-gated channel, Shab-related subfamily, member 1
chicken(428146) potassium voltage-gated channel, Shab-related subfamily, member 1
sheep(101121535) potassium voltage-gated channel, Shab-related subfamily, member 1
Domestic Rabbit(100008779) potassium voltage-gated channel, Shab-related subfamily, member 1
sheep(780775) potassium voltage-gated channel, Shab-related subfamily, member 1
domestic guinea pig(100725645) potassium voltage-gated channel, Shab-related subfamily, member 1
naked mole-rat(101703076) potassium voltage-gated channel, Shab-related subfamily, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101203 Anti-KCNB1 antibody produced in rabbit affinity isolated antibody horse, rat, bovine, human, pig, mouse, guinea pig, canine
western blot pricing
HPA042434 Anti-KCNB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB4501621 Anti-KV2.1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4504708 Anti-phospho-Kv2.1 (pSer805) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504255 Anti-phospho-Kv2.1/KCNB1 (pSer567) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
P9607 Anti-Potassium Channel Kv2.1 (DRK1) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder rat
immunocytochemistry, immunoprecipitation (IP), western blot pricing
SAB5200055 Monoclonal Anti-KCNB1 antibody produced in mouse clone S4-11, 1 mg/mL, purified immunoglobulin mouse, monkey, human, rat
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200065 Monoclonal Anti-KCNB1 antibody produced in mouse clone S39-25, 1 mg/mL, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200077 Monoclonal Anti-KCNB1 antibody produced in mouse clone S89-34, 1 mg/mL, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B0753 2,3-Butanedione monoxime ≥98% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004975 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004975 Rosetta Predictions human pricing
NM_013186 Rosetta Predictions rat pricing
NM_008420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214328 predicted 1283
2 SASI_Hs01_00214329 predicted 1539
3 SASI_Hs01_00214330 predicted 1531
4 SASI_Hs02_00338680 predicted 1069
5 SASI_Hs01_00214331 predicted 2155
6 SASI_Hs01_00214332 predicted 910
7 SASI_Hs01_00214334 predicted 2576
8 SASI_Hs01_00214335 predicted 726
9 SASI_Hs01_00214336 predicted 1898
10 SASI_Hs01_00214337 predicted 1138
11 SASI_Hs01_00214333 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067050 predicted 715
2 SASI_Rn01_00067051 predicted 430
3 SASI_Rn01_00067052 predicted 1606
4 SASI_Rn01_00067054 predicted 849
5 SASI_Rn01_00067055 predicted 823
6 SASI_Rn01_00067056 predicted 520
7 SASI_Rn01_00067057 predicted 1050
8 SASI_Rn01_00067058 predicted 2423
9 SASI_Rn01_00067059 predicted 2063
10 SASI_Rn02_00261020 predicted 2066
11 SASI_Rn01_00067053 predicted 2223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170657 predicted 1767
2 SASI_Mm01_00170658 predicted 1017
3 SASI_Mm01_00170660 predicted 1397
4 SASI_Mm01_00170661 predicted 729
5 SASI_Mm01_00170662 predicted 1395
6 SASI_Mm01_00170663 predicted 986
7 SASI_Mm01_00170664 predicted 2237
8 SASI_Mm01_00170665 predicted 2234
9 SASI_Mm02_00313878 predicted 1213
10 SASI_Mm02_00313879 predicted 2591
11 SASI_Mm01_00170656 predicted 1986
12 SASI_Mm01_00170659 predicted 2391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004975
KCNB1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shab-related subfamily, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-2171s1c1
Sequence:CCGGCCGAGCACTTAAAGTCAACTTCTCGAGAAGTTGACTTTAAGTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-2376s1c1
Sequence:CCGGCCTGAGAAACACACAGCAATACTCGAGTATTGCTGTGTGTTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-2579s1c1
Sequence:CCGGCCCTAAGTTCTTAAGGCAGAACTCGAGTTCTGCCTTAAGAACTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-944s1c1
Sequence:CCGGCCCACTCAATGCCATTGACTTCTCGAGAAGTCAATGGCATTGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-726s1c1
Sequence:CCGGGCCAAGATCCTTGCCATAATTCTCGAGAATTATGGCAAGGATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004975.2-638s21c1
Sequence:CCGGGGAAGGCGAGGAGTTCGATAACTCGAGTTATCGAACTCCTCGCCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004975.2-1899s21c1
Sequence:CCGGGTCATTGACATGCGAAGTATGCTCGAGCATACTTCGCATGTCAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004975
KCNB1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shab-related subfamily, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-2171s1c1
Sequence:CCGGCCGAGCACTTAAAGTCAACTTCTCGAGAAGTTGACTTTAAGTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-2376s1c1
Sequence:CCGGCCTGAGAAACACACAGCAATACTCGAGTATTGCTGTGTGTTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-2579s1c1
Sequence:CCGGCCCTAAGTTCTTAAGGCAGAACTCGAGTTCTGCCTTAAGAACTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-944s1c1
Sequence:CCGGCCCACTCAATGCCATTGACTTCTCGAGAAGTCAATGGCATTGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-726s1c1
Sequence:CCGGGCCAAGATCCTTGCCATAATTCTCGAGAATTATGGCAAGGATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004975.2-638s21c1
Sequence:CCGGGGAAGGCGAGGAGTTCGATAACTCGAGTTATCGAACTCCTCGCCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004975.2-1899s21c1
Sequence:CCGGGTCATTGACATGCGAAGTATGCTCGAGCATACTTCGCATGTCAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004975
KCNB1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shab-related subfamily, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-2171s1c1
Sequence:CCGGCCGAGCACTTAAAGTCAACTTCTCGAGAAGTTGACTTTAAGTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-2376s1c1
Sequence:CCGGCCTGAGAAACACACAGCAATACTCGAGTATTGCTGTGTGTTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-2579s1c1
Sequence:CCGGCCCTAAGTTCTTAAGGCAGAACTCGAGTTCTGCCTTAAGAACTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-944s1c1
Sequence:CCGGCCCACTCAATGCCATTGACTTCTCGAGAAGTCAATGGCATTGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004975.2-726s1c1
Sequence:CCGGGCCAAGATCCTTGCCATAATTCTCGAGAATTATGGCAAGGATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004975.2-638s21c1
Sequence:CCGGGGAAGGCGAGGAGTTCGATAACTCGAGTTATCGAACTCCTCGCCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004975.2-1899s21c1
Sequence:CCGGGTCATTGACATGCGAAGTATGCTCGAGCATACTTCGCATGTCAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008420
KCNB1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shab-related subfamily, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-1398s1c1
Sequence:CCGGCCCATTCCAATTATCGTCAATCTCGAGATTGACGATAATTGGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-2385s1c1
Sequence:CCGGCCAGAGAAACACACAGCAATACTCGAGTATTGCTGTGTGTTTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-930s1c1
Sequence:CCGGCCCAAGAAATGGAAGTTCTTTCTCGAGAAAGAACTTCCATTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-2533s1c1
Sequence:CCGGGCCTTGGAGCTAGAACAGAAACTCGAGTTTCTGTTCTAGCTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-446s1c1
Sequence:CCGGCGCCTTCACCTCTATTCTCAACTCGAGTTGAGAATAGAGGTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008420
KCNB1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shab-related subfamily, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-1398s1c1
Sequence:CCGGCCCATTCCAATTATCGTCAATCTCGAGATTGACGATAATTGGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-2385s1c1
Sequence:CCGGCCAGAGAAACACACAGCAATACTCGAGTATTGCTGTGTGTTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-930s1c1
Sequence:CCGGCCCAAGAAATGGAAGTTCTTTCTCGAGAAAGAACTTCCATTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-2533s1c1
Sequence:CCGGGCCTTGGAGCTAGAACAGAAACTCGAGTTTCTGTTCTAGCTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-446s1c1
Sequence:CCGGCGCCTTCACCTCTATTCTCAACTCGAGTTGAGAATAGAGGTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008420
KCNB1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shab-related subfamily, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-1398s1c1
Sequence:CCGGCCCATTCCAATTATCGTCAATCTCGAGATTGACGATAATTGGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-2385s1c1
Sequence:CCGGCCAGAGAAACACACAGCAATACTCGAGTATTGCTGTGTGTTTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-930s1c1
Sequence:CCGGCCCAAGAAATGGAAGTTCTTTCTCGAGAAAGAACTTCCATTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-2533s1c1
Sequence:CCGGGCCTTGGAGCTAGAACAGAAACTCGAGTTTCTGTTCTAGCTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008420.3-446s1c1
Sequence:CCGGCGCCTTCACCTCTATTCTCAACTCGAGTTGAGAATAGAGGTGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)