EMAIL THIS PAGE TO A FRIEND

KCNB2

potassium voltage-gated channel, Shab-related subfamily, member 2

89 Gene Product Result for
Synonyms: KV2.2
UniProtKB ID: Q92953, Q7Z7D0, Q9BXD3
Gene ID:
Human(9312) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
Mouse(98741) potassium voltage gated channel, Shab-related subfamily, member 2
Rat(117105) potassium voltage gated channel, Shab-related subfamily, member 2
domestic guinea pig(100713998) potassium voltage-gated channel, Shab-related subfamily, member 2
naked mole-rat(101726597) potassium voltage-gated channel, Shab-related subfamily, member 2
sheep(101106337) potassium voltage-gated channel, Shab-related subfamily, member 2
Domestic Rabbit(100008877) potassium voltage-gated channel, Shab-related subfamily, member 2
Zebrafish(555921) potassium voltage-gated channel, Shab-related subfamily, member 2
dog(403925) potassium voltage-gated channel, Shab-related subfamily, member 2
Horse(100051372) potassium voltage-gated channel, Shab-related subfamily, member 2
cow(535990) potassium voltage-gated channel, Shab-related subfamily, member 2
domestic cat(101081116) potassium voltage-gated channel, Shab-related subfamily, member 2
chicken(431181) potassium voltage-gated channel, Shab-related subfamily, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004770 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_136482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029651 MISSION® esiRNA esiRNA human KCNB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004770 Rosetta Predictions human pricing
NM_054000 Rosetta Predictions rat pricing
NM_001098528 Rosetta Predictions mouse pricing
XM_001473596 Rosetta Predictions mouse pricing
XM_001473804 Rosetta Predictions mouse pricing
XM_976837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338274 predicted 2534
2 SASI_Hs01_00109772 predicted 2683
3 SASI_Hs01_00109773 predicted 1682
4 SASI_Hs01_00109774 predicted 1252
5 SASI_Hs01_00109775 predicted 1583
6 SASI_Hs01_00109776 predicted 616
7 SASI_Hs01_00109777 predicted 2638
8 SASI_Hs01_00109778 predicted 2537
9 SASI_Hs01_00109779 predicted 1963
10 SASI_Hs01_00109780 predicted 2710
11 SASI_Hs01_00109781 predicted 3085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060391 predicted 1303
2 SASI_Rn01_00060392 predicted 1825
3 SASI_Rn01_00060393 predicted 2560
4 SASI_Rn01_00060394 predicted 1420
5 SASI_Rn01_00060395 predicted 1403
6 SASI_Rn01_00060396 predicted 512
7 SASI_Rn01_00060397 predicted 843
8 SASI_Rn01_00060398 predicted 1320
9 SASI_Rn01_00060400 predicted 1799
10 SASI_Rn02_00267003 predicted 977
11 SASI_Rn01_00060399 predicted 2807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301401 predicted 328
2 SASI_Mm02_00301402 predicted 2238
3 SASI_Mm02_00301403 predicted 1501
4 SASI_Mm02_00301404 predicted 1088
5 SASI_Mm02_00301405 predicted 1497
6 SASI_Mm02_00301406 predicted 1419
7 SASI_Mm02_00301407 predicted 2112
8 SASI_Mm02_00301408 predicted 1227
9 SASI_Mm02_00301409 predicted 912
10 SASI_Mm02_00301410 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00369229 predicted 333
2 SASI_Mm02_00369230 predicted 2239
3 SASI_Mm02_00369231 predicted 1504
4 SASI_Mm02_00369232 predicted 1096
5 SASI_Mm02_00369233 predicted 1491
6 SASI_Mm02_00369234 predicted 1424
7 SASI_Mm02_00369235 predicted 2112
8 SASI_Mm02_00369236 predicted 1225
9 SASI_Mm02_00369237 predicted 913
10 SASI_Mm02_00369238 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00370821 predicted 2497
2 SASI_Mm02_00370822 predicted 2307
3 SASI_Mm02_00370823 predicted 2240
4 SASI_Mm02_00370824 predicted 2080
5 SASI_Mm02_00370825 predicted 2106
6 SASI_Mm02_00370826 predicted 2121
7 SASI_Mm02_00370827 predicted 1228
8 SASI_Mm02_00370828 predicted 1911
9 SASI_Mm02_00370829 predicted 2124
10 SASI_Mm02_00370830 predicted 2228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238917 predicted 335
2 SASI_Mm01_00238918 predicted 2250
3 SASI_Mm01_00238919 predicted 1509
4 SASI_Mm01_00238920 predicted 1099
5 SASI_Mm01_00238921 predicted 1497
6 SASI_Mm01_00238922 predicted 1425
7 SASI_Mm01_00238923 predicted 2117
8 SASI_Mm01_00238924 predicted 1238
9 SASI_Mm01_00238925 predicted 295
10 SASI_Mm01_00238926 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004770
KCNB2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shab-related subfamily, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004770.2-1932s21c1
Sequence:CCGGCATCGTTTCTATGAACTTAAACTCGAGTTTAAGTTCATAGAAACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004770.2-1241s21c1
Sequence:CCGGTGCAGGAAACGGACGAATTTGCTCGAGCAAATTCGTCCGTTTCCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-1338s1c1
Sequence:CCGGGCGATTCTTATCCTCACCAAACTCGAGTTTGGTGAGGATAAGAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-1300s1c1
Sequence:CCGGGCTGTGTGTATTGCATGGTTTCTCGAGAAACCATGCAATACACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-822s1c1
Sequence:CCGGCGACTATAATCTGAACGAGAACTCGAGTTCTCGTTCAGATTATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-2954s1c1
Sequence:CCGGCCAAGCAGAAACTGTTCCCTTCTCGAGAAGGGAACAGTTTCTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-1963s1c1
Sequence:CCGGGCTCGAAGTATGGAACTGATACTCGAGTATCAGTTCCATACTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004770
KCNB2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shab-related subfamily, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004770.2-1932s21c1
Sequence:CCGGCATCGTTTCTATGAACTTAAACTCGAGTTTAAGTTCATAGAAACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004770.2-1241s21c1
Sequence:CCGGTGCAGGAAACGGACGAATTTGCTCGAGCAAATTCGTCCGTTTCCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-1338s1c1
Sequence:CCGGGCGATTCTTATCCTCACCAAACTCGAGTTTGGTGAGGATAAGAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-1300s1c1
Sequence:CCGGGCTGTGTGTATTGCATGGTTTCTCGAGAAACCATGCAATACACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-822s1c1
Sequence:CCGGCGACTATAATCTGAACGAGAACTCGAGTTCTCGTTCAGATTATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-2954s1c1
Sequence:CCGGCCAAGCAGAAACTGTTCCCTTCTCGAGAAGGGAACAGTTTCTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-1963s1c1
Sequence:CCGGGCTCGAAGTATGGAACTGATACTCGAGTATCAGTTCCATACTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004770
KCNB2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shab-related subfamily, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004770.2-1932s21c1
Sequence:CCGGCATCGTTTCTATGAACTTAAACTCGAGTTTAAGTTCATAGAAACGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004770.2-1241s21c1
Sequence:CCGGTGCAGGAAACGGACGAATTTGCTCGAGCAAATTCGTCCGTTTCCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-1338s1c1
Sequence:CCGGGCGATTCTTATCCTCACCAAACTCGAGTTTGGTGAGGATAAGAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-1300s1c1
Sequence:CCGGGCTGTGTGTATTGCATGGTTTCTCGAGAAACCATGCAATACACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-822s1c1
Sequence:CCGGCGACTATAATCTGAACGAGAACTCGAGTTCTCGTTCAGATTATAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-2954s1c1
Sequence:CCGGCCAAGCAGAAACTGTTCCCTTCTCGAGAAGGGAACAGTTTCTGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004770.2-1963s1c1
Sequence:CCGGGCTCGAAGTATGGAACTGATACTCGAGTATCAGTTCCATACTTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136482
KCNB2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shab-related subfamily, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-103s1c1
Sequence:CCGGCGGAGAGTTAAGATCAACGTACTCGAGTACGTTGATCTTAACTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-1559s1c1
Sequence:CCGGCCCACGAACATCTGAACAATACTCGAGTATTGTTCAGATGTTCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-1285s1c1
Sequence:CCGGCGCCAGGAGAAAGCTATTAAACTCGAGTTTAATAGCTTTCTCCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-2568s1c1
Sequence:CCGGCCACAACTGTAGGCAAGACATCTCGAGATGTCTTGCCTACAGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-1953s1c1
Sequence:CCGGCCTTACACTAAGCAGAGATAACTCGAGTTATCTCTGCTTAGTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136482
KCNB2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shab-related subfamily, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-103s1c1
Sequence:CCGGCGGAGAGTTAAGATCAACGTACTCGAGTACGTTGATCTTAACTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-1559s1c1
Sequence:CCGGCCCACGAACATCTGAACAATACTCGAGTATTGTTCAGATGTTCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-1285s1c1
Sequence:CCGGCGCCAGGAGAAAGCTATTAAACTCGAGTTTAATAGCTTTCTCCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-2568s1c1
Sequence:CCGGCCACAACTGTAGGCAAGACATCTCGAGATGTCTTGCCTACAGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-1953s1c1
Sequence:CCGGCCTTACACTAAGCAGAGATAACTCGAGTTATCTCTGCTTAGTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136482
KCNB2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shab-related subfamily, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-103s1c1
Sequence:CCGGCGGAGAGTTAAGATCAACGTACTCGAGTACGTTGATCTTAACTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-1559s1c1
Sequence:CCGGCCCACGAACATCTGAACAATACTCGAGTATTGTTCAGATGTTCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-1285s1c1
Sequence:CCGGCGCCAGGAGAAAGCTATTAAACTCGAGTTTAATAGCTTTCTCCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-2568s1c1
Sequence:CCGGCCACAACTGTAGGCAAGACATCTCGAGATGTCTTGCCTACAGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136482.3-1953s1c1
Sequence:CCGGCCTTACACTAAGCAGAGATAACTCGAGTTATCTCTGCTTAGTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)