EMAIL THIS PAGE TO A FRIEND

KCNC1

potassium voltage-gated channel, Shaw-related subfamily, member 1

87 Gene Product Result for
Synonyms: KV3.1 KV4 NGK2
UniProtKB ID: P48547
Gene ID:
Human(3746) Summary: The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Multiple transcript variants encoding different isoforms have been inferred for this gene based on orthologous loci. [provided by RefSeq, Jul 2008]
Mouse(16502) potassium voltage gated channel, Shaw-related subfamily, member 1
Rat(25327) potassium voltage gated channel, Shaw-related subfamily, member 1
chicken(423076) potassium voltage-gated channel, Shaw-related subfamily, member 1
cow(541459) potassium voltage-gated channel, Shaw-related subfamily, member 1
Horse(100056567) potassium voltage-gated channel, Shaw-related subfamily, member 1
domestic cat(101097914) potassium voltage-gated channel, Shaw-related subfamily, member 1
dog(403705) potassium voltage-gated channel, Shaw-related subfamily, member 1
sheep(101113880) potassium voltage-gated channel, Shaw-related subfamily, member 1
Domestic Rabbit(100008968) potassium voltage-gated channel, Shaw-related subfamily, member 1
domestic guinea pig(100717907) potassium voltage-gated channel, Shaw-related subfamily, member 1
naked mole-rat(101708212) potassium voltage-gated channel, Shaw-related subfamily, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004976 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112741 Rosetta Predictions human pricing
NM_004976 Rosetta Predictions human pricing
NM_012856 Rosetta Predictions rat pricing
NM_001112739 Rosetta Predictions mouse pricing
NM_008421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325525 predicted 1134
2 SASI_Hs02_00325526 predicted 1004
3 SASI_Hs02_00325527 predicted 799
4 SASI_Hs02_00325528 predicted 1189
5 SASI_Hs02_00325529 predicted 248
6 SASI_Hs02_00325530 predicted 618
7 SASI_Hs02_00325531 predicted 235
8 SASI_Hs02_00325532 predicted 1001
9 SASI_Hs02_00325533 predicted 755
10 SASI_Hs02_00325534 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054732 predicted 1135
2 SASI_Hs02_00338681 predicted 1000
3 SASI_Hs01_00054733 predicted 797
4 SASI_Hs01_00054734 predicted 1184
5 SASI_Hs01_00054735 predicted 241
6 SASI_Hs01_00054736 predicted 618
7 SASI_Hs01_00054737 predicted 239
8 SASI_Hs01_00054738 predicted 995
9 SASI_Hs01_00054739 predicted 750
10 SASI_Hs01_00054740 predicted 1186
11 SASI_Hs01_00054741 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082136 predicted 2290
2 SASI_Rn01_00082137 predicted 2751
3 SASI_Rn01_00082138 predicted 1940
4 SASI_Rn01_00082139 predicted 2737
5 SASI_Rn01_00082141 predicted 1814
6 SASI_Rn01_00082144 predicted 1811
7 SASI_Rn02_00260337 predicted 2743
8 SASI_Rn02_00260338 predicted 2042
9 SASI_Rn02_00260339 predicted 1757
10 SASI_Rn02_00260340 predicted 1835
11 SASI_Rn01_00082135 predicted 1962
12 SASI_Rn01_00082140 predicted 2192
13 SASI_Rn01_00082142 predicted 2189
14 SASI_Rn01_00082143 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307083 predicted 1852
2 SASI_Mm02_00307084 predicted 1369
3 SASI_Mm02_00307085 predicted 1363
4 SASI_Mm02_00307086 predicted 2058
5 SASI_Mm02_00307087 predicted 2002
6 SASI_Mm02_00307088 predicted 1828
7 SASI_Mm02_00307089 predicted 2060
8 SASI_Mm02_00307090 predicted 1358
9 SASI_Mm02_00307091 predicted 1997
10 SASI_Mm02_00307092 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028405 predicted 1885
2 SASI_Mm02_00313880 predicted 1396
3 SASI_Mm01_00028410 predicted 1390
4 SASI_Mm02_00313881 predicted 2091
5 SASI_Mm02_00313882 predicted 2035
6 SASI_Mm02_00313883 predicted 1859
7 SASI_Mm02_00313884 predicted 2087
8 SASI_Mm02_00313885 predicted 1394
9 SASI_Mm02_00313886 predicted 2029
10 SASI_Mm02_00313887 predicted 1866
11 SASI_Mm01_00028402 predicted 1269
12 SASI_Mm01_00028403 predicted 1787
13 SASI_Mm01_00028404 predicted 1226
14 SASI_Mm01_00028406 predicted 2027
15 SASI_Mm01_00028407 predicted 2035
16 SASI_Mm01_00028408 predicted 2176
17 SASI_Mm01_00028409 predicted 1872
18 SASI_Mm01_00028411 predicted 2148
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004976
KCNC1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shaw-related subfamily, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-1362s1c1
Sequence:CCGGGCCCGTCATCGTGAACAATTTCTCGAGAAATTGTTCACGATGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-1371s1c1
Sequence:CCGGCGTGAACAATTTCGGGATGTACTCGAGTACATCCCGAAATTGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-882s1c1
Sequence:CCGGGTTCATCAAGAACTCGCTCAACTCGAGTTGAGCGAGTTCTTGATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-717s1c1
Sequence:CCGGCATCGTGAACAAGACGGAGATCTCGAGATCTCCGTCTTGTTCACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-1206s1c1
Sequence:CCGGGCACACGCACTTTAAGAACATCTCGAGATGTTCTTAAAGTGCGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004976.4-248s21c1
Sequence:CCGGGCGCACATCCTGAACTACTACCTCGAGGTAGTAGTTCAGGATGTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004976.4-1833s21c1
Sequence:CCGGGGTTGCTGAGGACTAACTTAGCTCGAGCTAAGTTAGTCCTCAGCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004976.4-1466s21c1
Sequence:CCGGTATTGTAAATCTGTCGTAAACCTCGAGGTTTACGACAGATTTACAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004976.4-1397s21c1
Sequence:CCAGGCTAAGCAGAAACTACCAAAGCTCGAGCTTTGGTAGTTTCTGCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004976
KCNC1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shaw-related subfamily, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-1362s1c1
Sequence:CCGGGCCCGTCATCGTGAACAATTTCTCGAGAAATTGTTCACGATGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-1371s1c1
Sequence:CCGGCGTGAACAATTTCGGGATGTACTCGAGTACATCCCGAAATTGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-882s1c1
Sequence:CCGGGTTCATCAAGAACTCGCTCAACTCGAGTTGAGCGAGTTCTTGATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-717s1c1
Sequence:CCGGCATCGTGAACAAGACGGAGATCTCGAGATCTCCGTCTTGTTCACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-1206s1c1
Sequence:CCGGGCACACGCACTTTAAGAACATCTCGAGATGTTCTTAAAGTGCGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004976.4-248s21c1
Sequence:CCGGGCGCACATCCTGAACTACTACCTCGAGGTAGTAGTTCAGGATGTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004976.4-1833s21c1
Sequence:CCGGGGTTGCTGAGGACTAACTTAGCTCGAGCTAAGTTAGTCCTCAGCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004976.4-1466s21c1
Sequence:CCGGTATTGTAAATCTGTCGTAAACCTCGAGGTTTACGACAGATTTACAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004976.4-1397s21c1
Sequence:CCAGGCTAAGCAGAAACTACCAAAGCTCGAGCTTTGGTAGTTTCTGCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004976
KCNC1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shaw-related subfamily, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-1362s1c1
Sequence:CCGGGCCCGTCATCGTGAACAATTTCTCGAGAAATTGTTCACGATGACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-1371s1c1
Sequence:CCGGCGTGAACAATTTCGGGATGTACTCGAGTACATCCCGAAATTGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-882s1c1
Sequence:CCGGGTTCATCAAGAACTCGCTCAACTCGAGTTGAGCGAGTTCTTGATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-717s1c1
Sequence:CCGGCATCGTGAACAAGACGGAGATCTCGAGATCTCCGTCTTGTTCACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004976.2-1206s1c1
Sequence:CCGGGCACACGCACTTTAAGAACATCTCGAGATGTTCTTAAAGTGCGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004976.4-248s21c1
Sequence:CCGGGCGCACATCCTGAACTACTACCTCGAGGTAGTAGTTCAGGATGTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004976.4-1833s21c1
Sequence:CCGGGGTTGCTGAGGACTAACTTAGCTCGAGCTAAGTTAGTCCTCAGCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004976.4-1466s21c1
Sequence:CCGGTATTGTAAATCTGTCGTAAACCTCGAGGTTTACGACAGATTTACAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004976.4-1397s21c1
Sequence:CCAGGCTAAGCAGAAACTACCAAAGCTCGAGCTTTGGTAGTTTCTGCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008421
VALIDATED
KCNC1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shaw-related subfamily, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008421.1-1269s1c1
Sequence:CCGGCCAGCGAACACACACACTTTACTCGAGTAAAGTGTGTGTGTTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008421.1-1472s1c1
Sequence:CCGGGCCATGGCTAAGCAGAAACTACTCGAGTAGTTTCTGCTTAGCCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008421.1-328s1c1
Sequence:CCGGCGCTCACATCCTGAACTATTACTCGAGTAATAGTTCAGGATGTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008421.1-1530s1c1
Sequence:CCGGAGCTGGGATCTCCCAATTATTCTCGAGAATAATTGGGAGATCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008421.1-786s1c1
Sequence:CCGGCCATCGTGAACAAGACCGAAACTCGAGTTTCGGTCTTGTTCACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-1989s21c1
Sequence:CCGGTCCTCATGCGTGTCGTCTTCTCTCGAGAGAAGACGACACGCATGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008421.3-3713s21c1
Sequence:CCGGCTAGTCACCGAGGGATATATTCTCGAGAATATATCCCTCGGTGACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-2029s21c1
Sequence:CCGGCATCAAGAACTCCCTCAATATCTCGAGATATTGAGGGAGTTCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-2724s21c1
Sequence:CCGGCTCTCAGAGGCATGTCGATCTCTCGAGAGATCGACATGCCTCTGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-1336s21c1
Sequence:CCGGCCACAGCCACTTCGACTATGACTCGAGTCATAGTCGAAGTGGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008421
VALIDATED
KCNC1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shaw-related subfamily, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008421.1-1269s1c1
Sequence:CCGGCCAGCGAACACACACACTTTACTCGAGTAAAGTGTGTGTGTTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008421.1-1472s1c1
Sequence:CCGGGCCATGGCTAAGCAGAAACTACTCGAGTAGTTTCTGCTTAGCCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008421.1-328s1c1
Sequence:CCGGCGCTCACATCCTGAACTATTACTCGAGTAATAGTTCAGGATGTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008421.1-1530s1c1
Sequence:CCGGAGCTGGGATCTCCCAATTATTCTCGAGAATAATTGGGAGATCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008421.1-786s1c1
Sequence:CCGGCCATCGTGAACAAGACCGAAACTCGAGTTTCGGTCTTGTTCACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-1989s21c1
Sequence:CCGGTCCTCATGCGTGTCGTCTTCTCTCGAGAGAAGACGACACGCATGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008421.3-3713s21c1
Sequence:CCGGCTAGTCACCGAGGGATATATTCTCGAGAATATATCCCTCGGTGACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-2029s21c1
Sequence:CCGGCATCAAGAACTCCCTCAATATCTCGAGATATTGAGGGAGTTCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-2724s21c1
Sequence:CCGGCTCTCAGAGGCATGTCGATCTCTCGAGAGATCGACATGCCTCTGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-1336s21c1
Sequence:CCGGCCACAGCCACTTCGACTATGACTCGAGTCATAGTCGAAGTGGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008421
VALIDATED
KCNC1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shaw-related subfamily, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008421.1-1269s1c1
Sequence:CCGGCCAGCGAACACACACACTTTACTCGAGTAAAGTGTGTGTGTTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008421.1-1472s1c1
Sequence:CCGGGCCATGGCTAAGCAGAAACTACTCGAGTAGTTTCTGCTTAGCCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008421.1-328s1c1
Sequence:CCGGCGCTCACATCCTGAACTATTACTCGAGTAATAGTTCAGGATGTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008421.1-1530s1c1
Sequence:CCGGAGCTGGGATCTCCCAATTATTCTCGAGAATAATTGGGAGATCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008421.1-786s1c1
Sequence:CCGGCCATCGTGAACAAGACCGAAACTCGAGTTTCGGTCTTGTTCACGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-1989s21c1
Sequence:CCGGTCCTCATGCGTGTCGTCTTCTCTCGAGAGAAGACGACACGCATGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008421.3-3713s21c1
Sequence:CCGGCTAGTCACCGAGGGATATATTCTCGAGAATATATCCCTCGGTGACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-2029s21c1
Sequence:CCGGCATCAAGAACTCCCTCAATATCTCGAGATATTGAGGGAGTTCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-2724s21c1
Sequence:CCGGCTCTCAGAGGCATGTCGATCTCTCGAGAGATCGACATGCCTCTGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008421.3-1336s21c1
Sequence:CCGGCCACAGCCACTTCGACTATGACTCGAGTCATAGTCGAAGTGGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)