EMAIL THIS PAGE TO A FRIEND

KCNC2

potassium voltage-gated channel, Shaw-related subfamily, member 2

203 Gene Product Result for
Synonyms: KV3.2
Gene ID:
Human(3747) Summary: The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(268345) potassium voltage gated channel, Shaw-related subfamily, member 2
Rat(246153) potassium voltage gated channel, Shaw-related subfamily, member 2
Zebrafish(100037377) potassium voltage-gated channel, Shaw-related subfamily, member 2
chicken(772061) potassium voltage-gated channel, Shaw-related subfamily, member 2
domestic cat(101086322) potassium voltage-gated channel, Shaw-related subfamily, member 2
Horse(100050104) potassium voltage-gated channel, Shaw-related subfamily, member 2
cow(539913) potassium voltage-gated channel, Shaw-related subfamily, member 2
dog(481168) potassium voltage-gated channel, Shaw-related subfamily, member 2
domestic guinea pig(100716944) potassium voltage-gated channel, Shaw-related subfamily, member 2
naked mole-rat(101711507) potassium voltage-gated channel, Shaw-related subfamily, member 2
sheep(101122852) potassium voltage-gated channel, Shaw-related subfamily, member 2
Domestic Rabbit(100345412) potassium voltage-gated channel, Shaw-related subfamily, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21022 Anti-KCNC2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat
western blot pricing
HPA019664 Anti-KV3.2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
P9857 Anti-Potassium Channel Kv3.2 antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4501622 Anti-Potassium Channel Kv3.2b antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB5202202 Monoclonal Anti-Kv3.2 antibody produced in mouse clone S410-17 New mouse, human
immunofluorescence, western blot pricing
SAB5202211 Monoclonal Anti-Kv3.2-Alkaline Phosphatase antibody produced in mouse clone S410-17 New human, mouse
immunofluorescence, western blot pricing
SAB5202212 Monoclonal Anti-Kv3.2-Allophycocyanin antibody produced in mouse clone S410-17 New mouse, human
immunofluorescence, western blot pricing
SAB5202203 Monoclonal Anti-Kv3.2-Atto 390 antibody produced in mouse clone S410-17 New mouse, human
immunofluorescence, western blot pricing
SAB5202204 Monoclonal Anti-Kv3.2-Atto 488 antibody produced in mouse clone S410-17 New mouse, human
immunofluorescence, western blot pricing
SAB5202206 Monoclonal Anti-Kv3.2-Atto 594 antibody produced in mouse clone S410-17 New human, mouse
immunofluorescence, western blot pricing
SAB5202205 Monoclonal Anti-Kv3.2-Atto 595 antibody produced in mouse clone S410-17 New human, mouse
immunofluorescence, western blot pricing
SAB5202207 Monoclonal Anti-Kv3.2-Atto 633 antibody produced in mouse clone S410-17 New mouse, human
immunofluorescence, western blot pricing
SAB5202208 Monoclonal Anti-Kv3.2-Atto 655 antibody produced in mouse clone S410-17 New mouse, human
immunofluorescence, western blot pricing
SAB5202209 Monoclonal Anti-Kv3.2-Atto 680 antibody produced in mouse clone S410-17 New mouse, human
immunofluorescence, western blot pricing
SAB5202210 Monoclonal Anti-Kv3.2-Atto 700 antibody produced in mouse clone S410-17 New human, mouse
immunofluorescence, western blot pricing
SAB5202213 Monoclonal Anti-Kv3.2-Biotin antibody produced in mouse clone S410-17 New mouse, human
immunofluorescence, western blot pricing
SAB5202214 Monoclonal Anti-Kv3.2-FITC antibody produced in mouse clone S410-17 New human, mouse
immunofluorescence, western blot pricing
SAB5202215 Monoclonal Anti-Kv3.2-Horseradish Peroxidase antibody produced in mouse clone S410-17 New mouse, human
immunofluorescence, western blot pricing
SAB5202216 Monoclonal Anti-Kv3.2-PE/Atto 594 antibody produced in mouse clone S410-17 New human, mouse
immunofluorescence, western blot pricing
SAB5202217 Monoclonal Anti-Kv3.2-PerCP antibody produced in mouse clone S410-17 New mouse, human
immunofluorescence, western blot pricing
SAB5202218 Monoclonal Anti-Kv3.2-R-Phycoerythrin antibody produced in mouse clone S410-17 New human, mouse
immunofluorescence, western blot pricing
SAB5202219 Monoclonal Anti-Kv3.2-Streptavidin antibody produced in mouse clone S410-17 New human, mouse
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139136 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139136 Rosetta Predictions human pricing
NM_139137 Rosetta Predictions human pricing
NM_153748 Rosetta Predictions human pricing
NM_139216 Rosetta Predictions rat pricing
NM_139217 Rosetta Predictions rat pricing
NM_001025581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073874 predicted 1318
2 SASI_Hs02_00364151 predicted 1321
3 SASI_Hs01_00073875 predicted 1338
4 SASI_Hs01_00073876 predicted 1765
5 SASI_Hs01_00073877 predicted 1182
6 SASI_Hs01_00073878 predicted 1529
7 SASI_Hs02_00364152 predicted 1370
8 SASI_Hs02_00364153 predicted 1783
9 SASI_Hs01_00073880 predicted 1739
10 SASI_Hs01_00073882 predicted 1452
11 SASI_Hs01_00073873 predicted 1550
12 SASI_Hs01_00073879 predicted 1787
13 SASI_Hs01_00073881 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014011 predicted 1324
2 SASI_Hs02_00364154 predicted 1323
3 SASI_Hs01_00014012 predicted 1338
4 SASI_Hs01_00014013 predicted 1765
5 SASI_Hs01_00014014 predicted 1177
6 SASI_Hs01_00014015 predicted 1537
7 SASI_Hs02_00364155 predicted 1372
8 SASI_Hs02_00364156 predicted 1779
9 SASI_Hs01_00014017 predicted 1735
10 SASI_Hs01_00014019 predicted 1452
11 SASI_Hs01_00014010 predicted 1551
12 SASI_Hs01_00014016 predicted 1782
13 SASI_Hs01_00014018 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227965 predicted 1320
2 SASI_Hs02_00367462 predicted 1321
3 SASI_Hs01_00227966 predicted 1344
4 SASI_Hs01_00227967 predicted 1768
5 SASI_Hs01_00227968 predicted 1181
6 SASI_Hs01_00227969 predicted 1530
7 SASI_Hs02_00367463 predicted 1373
8 SASI_Hs02_00367464 predicted 1784
9 SASI_Hs01_00227971 predicted 1734
10 SASI_Hs01_00227973 predicted 1449
11 SASI_Hs01_00227964 predicted 1544
12 SASI_Hs01_00227970 predicted 1782
13 SASI_Hs01_00227972 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113571 predicted 1158
2 SASI_Rn01_00113572 predicted 826
3 SASI_Rn01_00113573 predicted 1500
4 SASI_Rn01_00113574 predicted 1154
5 SASI_Rn01_00113575 predicted 630
6 SASI_Rn01_00113576 predicted 1195
7 SASI_Rn01_00113578 predicted 1375
8 SASI_Rn01_00113579 predicted 984
9 SASI_Rn01_00113580 predicted 1091
10 SASI_Rn02_00268525 predicted 1605
11 SASI_Rn01_00113577 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060570 predicted 1118
2 SASI_Rn01_00060571 predicted 779
3 SASI_Rn01_00060572 predicted 1464
4 SASI_Rn01_00060573 predicted 1113
5 SASI_Rn01_00060574 predicted 590
6 SASI_Rn01_00060575 predicted 1151
7 SASI_Rn01_00060577 predicted 1333
8 SASI_Rn01_00060578 predicted 949
9 SASI_Rn01_00060579 predicted 1054
10 SASI_Rn02_00268526 predicted 1567
11 SASI_Rn01_00060576 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133582 predicted 1758
2 SASI_Mm01_00133583 predicted 1684
3 SASI_Mm01_00133584 predicted 2022
4 SASI_Mm01_00133585 predicted 1092
5 SASI_Mm01_00133586 predicted 1136
6 SASI_Mm01_00133587 predicted 1749
7 SASI_Mm01_00133588 predicted 1908
8 SASI_Mm01_00133589 predicted 1639
9 SASI_Mm01_00133590 predicted 1997
10 SASI_Mm02_00287929 predicted 1111
11 SASI_Mm01_00133581 predicted 1982
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139136
KCNC2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shaw-related subfamily, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139136.2-1664s21c1
Sequence:CCGGACTCTTCGAGCTAGTACTAATCTCGAGATTAGTACTAGCTCGAAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139136.2-2808s21c1
Sequence:CCGGGTTGTGCTGTGAATTACTTAACTCGAGTTAAGTAATTCACAGCACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-1382s1c1
Sequence:CCGGCCTGCCTTGACGTATGTAGAACTCGAGTTCTACATACGTCAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-1546s1c1
Sequence:CCGGGCTGTCATCCAAAGCTGCTAACTCGAGTTAGCAGCTTTGGATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-1261s1c1
Sequence:CCGGCCTGGTTTCAATTACAACTTTCTCGAGAAAGTTGTAATTGAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-2120s1c1
Sequence:CCGGCTGGGCAAAGACAATCGACTTCTCGAGAAGTCGATTGTCTTTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-2228s1c1
Sequence:CCGGCGCTCTAGTACCAGAGACAAACTCGAGTTTGTCTCTGGTACTAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139136
KCNC2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shaw-related subfamily, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139136.2-1664s21c1
Sequence:CCGGACTCTTCGAGCTAGTACTAATCTCGAGATTAGTACTAGCTCGAAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139136.2-2808s21c1
Sequence:CCGGGTTGTGCTGTGAATTACTTAACTCGAGTTAAGTAATTCACAGCACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-1382s1c1
Sequence:CCGGCCTGCCTTGACGTATGTAGAACTCGAGTTCTACATACGTCAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-1546s1c1
Sequence:CCGGGCTGTCATCCAAAGCTGCTAACTCGAGTTAGCAGCTTTGGATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-1261s1c1
Sequence:CCGGCCTGGTTTCAATTACAACTTTCTCGAGAAAGTTGTAATTGAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-2120s1c1
Sequence:CCGGCTGGGCAAAGACAATCGACTTCTCGAGAAGTCGATTGTCTTTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-2228s1c1
Sequence:CCGGCGCTCTAGTACCAGAGACAAACTCGAGTTTGTCTCTGGTACTAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139136
KCNC2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shaw-related subfamily, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139136.2-1664s21c1
Sequence:CCGGACTCTTCGAGCTAGTACTAATCTCGAGATTAGTACTAGCTCGAAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139136.2-2808s21c1
Sequence:CCGGGTTGTGCTGTGAATTACTTAACTCGAGTTAAGTAATTCACAGCACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-1382s1c1
Sequence:CCGGCCTGCCTTGACGTATGTAGAACTCGAGTTCTACATACGTCAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-1546s1c1
Sequence:CCGGGCTGTCATCCAAAGCTGCTAACTCGAGTTAGCAGCTTTGGATGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-1261s1c1
Sequence:CCGGCCTGGTTTCAATTACAACTTTCTCGAGAAAGTTGTAATTGAAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-2120s1c1
Sequence:CCGGCTGGGCAAAGACAATCGACTTCTCGAGAAGTCGATTGTCTTTGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139136.2-2228s1c1
Sequence:CCGGCGCTCTAGTACCAGAGACAAACTCGAGTTTGTCTCTGGTACTAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025581
KCNC2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shaw-related subfamily, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025581.1-5161s1c1
Sequence:CCGGCCCGCATCTTATGAGGCATTTCTCGAGAAATGCCTCATAAGATGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-404s1c1
Sequence:CCGGGTATTCGCCTATGTGCTCAATCTCGAGATTGAGCACATAGGCGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-947s1c1
Sequence:CCGGGTGTGGTTTACGTTTGAATTTCTCGAGAAATTCAAACGTAAACCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-1725s1c1
Sequence:CCGGCGCCATTATCACCTCCAGAAACTCGAGTTTCTGGAGGTGATAATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-1887s1c1
Sequence:CCGGCACAGACTAAAGGAGACACAACTCGAGTTGTGTCTCCTTTAGTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025581
KCNC2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shaw-related subfamily, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025581.1-5161s1c1
Sequence:CCGGCCCGCATCTTATGAGGCATTTCTCGAGAAATGCCTCATAAGATGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-404s1c1
Sequence:CCGGGTATTCGCCTATGTGCTCAATCTCGAGATTGAGCACATAGGCGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-947s1c1
Sequence:CCGGGTGTGGTTTACGTTTGAATTTCTCGAGAAATTCAAACGTAAACCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-1725s1c1
Sequence:CCGGCGCCATTATCACCTCCAGAAACTCGAGTTTCTGGAGGTGATAATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-1887s1c1
Sequence:CCGGCACAGACTAAAGGAGACACAACTCGAGTTGTGTCTCCTTTAGTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025581
KCNC2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shaw-related subfamily, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025581.1-5161s1c1
Sequence:CCGGCCCGCATCTTATGAGGCATTTCTCGAGAAATGCCTCATAAGATGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-404s1c1
Sequence:CCGGGTATTCGCCTATGTGCTCAATCTCGAGATTGAGCACATAGGCGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-947s1c1
Sequence:CCGGGTGTGGTTTACGTTTGAATTTCTCGAGAAATTCAAACGTAAACCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-1725s1c1
Sequence:CCGGCGCCATTATCACCTCCAGAAACTCGAGTTTCTGGAGGTGATAATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025581.1-1887s1c1
Sequence:CCGGCACAGACTAAAGGAGACACAACTCGAGTTGTGTCTCCTTTAGTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)