EMAIL THIS PAGE TO A FRIEND

KCNC3

potassium voltage-gated channel, Shaw-related subfamily, member 3

187 Gene Product Result for
Synonyms: KSHIIID KV3.3 SCA13
UniProtKB ID: Q14003
Gene ID:
Human(3748) Summary: The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. [provided by RefSeq, Jul 2008]
Mouse(16504) potassium voltage gated channel, Shaw-related subfamily, member 3
Rat(117101) potassium voltage gated channel, Shaw-related subfamily, member 3
sheep(101116251) potassium voltage-gated channel, Shaw-related subfamily, member 3
Domestic Rabbit(100009368) potassium voltage-gated channel, Shaw-related subfamily, member 3
domestic guinea pig(100720775) potassium voltage-gated channel, Shaw-related subfamily, member 3
naked mole-rat(101728698) potassium voltage-gated channel, Shaw-related subfamily, member 3
domestic cat(101099418) potassium voltage-gated channel, Shaw-related subfamily, member 3
cow(617852) potassium voltage-gated channel, Shaw-related subfamily, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
D7148 3,4-Diaminopyridine ≥98% human pricing
36687 4-Aminopyridine PESTANAL®, analytical standard human pricing
1162454 Dalfampridine United States Pharmacopeia (USP) Reference Standard human pricing
PH016683 Guanidine AldrichCPR human pricing
G11659 Guanidine carbonate salt 99% human pricing
50930 Guanidine carbonate salt purum, ≥97.0% (NT) human pricing
G3272 Guanidine hydrochloride for molecular biology, ≥99% human pricing
G4505 Guanidine hydrochloride organic base and chaeotropic agent, ≥99% (titration) human pricing
50950 Guanidine hydrochloride ≥98% human pricing
PHG0006 Guanidine hydrochloride PharmaGrade, Manufactured under appropriate controls for use as a raw material in pharma or biopharmaceutical production. human pricing
50933 Guanidine hydrochloride BioUltra, for molecular biology, ≥99.5% (AT) human pricing
RDD001 Guanidine hydrochloride anhydrous, free-flowing, Redi-Dri, ≥99% human pricing
50940 Guanidine hydrochloride ≥99.0% (AT) human pricing
V900385 Guanidine hydrochloride Vetec reagent grade, ≥98% human pricing
12-1660 Guanidine hydrochloride SAJ special grade, ≥99.0% human pricing
12-1665 Guanidine hydrochloride ≥99.5% human pricing
G11705 Guanidine hydrochloride 92% human pricing
G7153 Guanidine hydrochloride BioXtra, ≥99.5% (titration) human pricing
G4630 Guanidine hydrochloride ≥98% human pricing
G9284 Guanidine hydrochloride solution human pricing
50937 Guanidine hydrochloride solution BioUltra, ~8 M in H2O human pricing
275875 4-Aminopyridine ≥99% human, mouse, rat pricing
A78403 4-Aminopyridine 98% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004977 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138541 MISSION® esiRNA esiRNA human KCNC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004977 Rosetta Predictions human pricing
NM_053997 Rosetta Predictions rat pricing
NM_008422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082316 predicted 1399
2 SASI_Hs01_00082317 predicted 1399
3 SASI_Hs01_00082318 predicted 1429
4 SASI_Hs01_00082319 predicted 1731
5 SASI_Hs01_00082320 predicted 1391
6 SASI_Hs01_00082321 predicted 2369
7 SASI_Hs01_00082322 predicted 1295
8 SASI_Hs01_00082323 predicted 2388
9 SASI_Hs01_00082324 predicted 2389
10 SASI_Hs01_00082325 predicted 1733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097136 predicted 2163
2 SASI_Rn01_00097137 predicted 1222
3 SASI_Rn01_00097139 predicted 842
4 SASI_Rn01_00097140 predicted 1547
5 SASI_Rn01_00097141 predicted 1155
6 SASI_Rn02_00266995 predicted 2164
7 SASI_Rn01_00097142 predicted 2119
8 SASI_Rn01_00097143 predicted 1107
9 SASI_Rn01_00097144 predicted 1352
10 SASI_Rn01_00097145 predicted 2331
11 SASI_Rn01_00097138 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068143 predicted 937
2 SASI_Mm01_00068146 predicted 621
3 SASI_Mm01_00068147 predicted 931
4 SASI_Mm01_00068148 predicted 996
5 SASI_Mm01_00068149 predicted 1255
6 SASI_Mm01_00068150 predicted 881
7 SASI_Mm02_00313888 predicted 2121
8 SASI_Mm01_00068151 predicted 1336
9 SASI_Mm01_00068152 predicted 1114
10 SASI_Mm02_00313889 predicted 1438
11 SASI_Mm01_00068144 predicted 1818
12 SASI_Mm01_00068145 predicted 1102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004977
KCNC3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shaw-related subfamily, member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1406s1c1
Sequence:CCGGCCAGACAAGGTGGAGTTTCTTCTCGAGAAGAAACTCCACCTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1236s1c1
Sequence:CCGGGCTTCATCCATATTAGCAACACTCGAGTGTTGCTAATATGGATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1738s1c1
Sequence:CCGGCTCCAACCACACCTACTTCAACTCGAGTTGAAGTAGGTGTGGTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1901s1c1
Sequence:CCGGCCCGTCATTGTCAACAACTTTCTCGAGAAAGTTGTTGACAATGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004977.2-2922s21c1
Sequence:CCGGGCCTTCTTGGACCCTTTAAAGCTCGAGCTTTAAAGGGTCCAAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004977.2-554s21c1
Sequence:CCGGAGCGGCAAGATCGTGATCAACCTCGAGGTTGATCACGATCTTGCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004977.2-2414s21c1
Sequence:CCGGTGCTTCCTCCTCACCGACTATCTCGAGATAGTCGGTGAGGAGGAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004977
KCNC3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shaw-related subfamily, member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1406s1c1
Sequence:CCGGCCAGACAAGGTGGAGTTTCTTCTCGAGAAGAAACTCCACCTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1236s1c1
Sequence:CCGGGCTTCATCCATATTAGCAACACTCGAGTGTTGCTAATATGGATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1738s1c1
Sequence:CCGGCTCCAACCACACCTACTTCAACTCGAGTTGAAGTAGGTGTGGTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1901s1c1
Sequence:CCGGCCCGTCATTGTCAACAACTTTCTCGAGAAAGTTGTTGACAATGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004977.2-2922s21c1
Sequence:CCGGGCCTTCTTGGACCCTTTAAAGCTCGAGCTTTAAAGGGTCCAAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004977.2-554s21c1
Sequence:CCGGAGCGGCAAGATCGTGATCAACCTCGAGGTTGATCACGATCTTGCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004977.2-2414s21c1
Sequence:CCGGTGCTTCCTCCTCACCGACTATCTCGAGATAGTCGGTGAGGAGGAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004977
KCNC3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shaw-related subfamily, member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1406s1c1
Sequence:CCGGCCAGACAAGGTGGAGTTTCTTCTCGAGAAGAAACTCCACCTTGTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1236s1c1
Sequence:CCGGGCTTCATCCATATTAGCAACACTCGAGTGTTGCTAATATGGATGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1738s1c1
Sequence:CCGGCTCCAACCACACCTACTTCAACTCGAGTTGAAGTAGGTGTGGTTGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004977.2-1901s1c1
Sequence:CCGGCCCGTCATTGTCAACAACTTTCTCGAGAAAGTTGTTGACAATGACGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000433006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004977.2-2922s21c1
Sequence:CCGGGCCTTCTTGGACCCTTTAAAGCTCGAGCTTTAAAGGGTCCAAGAAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004977.2-554s21c1
Sequence:CCGGAGCGGCAAGATCGTGATCAACCTCGAGGTTGATCACGATCTTGCCGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004977.2-2414s21c1
Sequence:CCGGTGCTTCCTCCTCACCGACTATCTCGAGATAGTCGGTGAGGAGGAAGCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008422
KCNC3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shaw-related subfamily, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-1394s1c1
Sequence:CCGGGCATGTACTATTCACTGGCTACTCGAGTAGCCAGTGAATAGTACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-30s1c1
Sequence:CCGGCAGCGGTAAGATCGTGATCAACTCGAGTTGATCACGATCTTACCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-874s1c1
Sequence:CCGGTGCCCAGATAAGGTGGAGTTTCTCGAGAAACTCCACCTTATCTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-651s1c1
Sequence:CCGGCTCCCTATTCTTTATCCTCATCTCGAGATGAGGATAAAGAATAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-1104s1c1
Sequence:CCGGCGAATTCTTGTTACTCATCATCTCGAGATGATGAGTAACAAGAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008422
KCNC3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shaw-related subfamily, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-1394s1c1
Sequence:CCGGGCATGTACTATTCACTGGCTACTCGAGTAGCCAGTGAATAGTACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-30s1c1
Sequence:CCGGCAGCGGTAAGATCGTGATCAACTCGAGTTGATCACGATCTTACCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-874s1c1
Sequence:CCGGTGCCCAGATAAGGTGGAGTTTCTCGAGAAACTCCACCTTATCTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-651s1c1
Sequence:CCGGCTCCCTATTCTTTATCCTCATCTCGAGATGAGGATAAAGAATAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-1104s1c1
Sequence:CCGGCGAATTCTTGTTACTCATCATCTCGAGATGATGAGTAACAAGAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008422
KCNC3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shaw-related subfamily, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-1394s1c1
Sequence:CCGGGCATGTACTATTCACTGGCTACTCGAGTAGCCAGTGAATAGTACATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-30s1c1
Sequence:CCGGCAGCGGTAAGATCGTGATCAACTCGAGTTGATCACGATCTTACCGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-874s1c1
Sequence:CCGGTGCCCAGATAAGGTGGAGTTTCTCGAGAAACTCCACCTTATCTGGGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-651s1c1
Sequence:CCGGCTCCCTATTCTTTATCCTCATCTCGAGATGAGGATAAAGAATAGGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000069459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008422.1-1104s1c1
Sequence:CCGGCGAATTCTTGTTACTCATCATCTCGAGATGATGAGTAACAAGAATTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???