EMAIL THIS PAGE TO A FRIEND

KCNC4

potassium voltage-gated channel, Shaw-related subfamily, member 4

199 Gene Product Result for
Synonyms: C1orf30 HKSHIIIC KSHIIIC KV3.4
UniProtKB ID: Q03721, Q3MIM4, Q5TBI6
Gene ID:
Human(3749) Summary: The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. It generates atypical voltage-dependent transient current that may be important for neuronal excitability. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(99738) potassium voltage gated channel, Shaw-related subfamily, member 4
Rat(684516) potassium voltage gated channel, Shaw-related subfamily, member 4
Zebrafish(799410) potassium voltage-gated channel, Shaw-related subfamily, member 4
cow(540768) potassium voltage-gated channel, Shaw-related subfamily, member 4
Horse(100058505) potassium voltage-gated channel, Shaw-related subfamily, member 4
domestic cat(101081563) potassium voltage-gated channel, Shaw-related subfamily, member 4
dog(490114) potassium voltage-gated channel, Shaw-related subfamily, member 4
chicken(419806) potassium voltage-gated channel, Shaw-related subfamily, member 4
domestic guinea pig(100734488) potassium voltage-gated channel, Shaw-related subfamily, member 4
naked mole-rat(101714189) potassium voltage-gated channel, Shaw-related subfamily, member 4
sheep(101105210) potassium voltage-gated channel, Shaw-related subfamily, member 4
Domestic Rabbit(100009422) potassium voltage-gated channel, Shaw-related subfamily, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004978 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039574 Rosetta Predictions human pricing
NM_004978 Rosetta Predictions human pricing
NM_153763 Rosetta Predictions human pricing
XM_001070801 Rosetta Predictions rat pricing
NM_145922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076492 predicted 861
2 SASI_Hs01_00076493 predicted 914
3 SASI_Hs01_00076494 predicted 827
4 SASI_Hs01_00076495 predicted 795
5 SASI_Hs01_00076496 predicted 907
6 SASI_Hs01_00076497 predicted 800
7 SASI_Hs01_00076498 predicted 788
8 SASI_Hs01_00076499 predicted 1288
9 SASI_Hs01_00076500 predicted 843
10 SASI_Hs01_00076501 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016205 predicted 855
2 SASI_Hs01_00016206 predicted 911
3 SASI_Hs01_00016207 predicted 831
4 SASI_Hs01_00016208 predicted 792
5 SASI_Hs01_00016209 predicted 912
6 SASI_Hs01_00016210 predicted 803
7 SASI_Hs01_00016211 predicted 787
8 SASI_Hs01_00016212 predicted 1290
9 SASI_Hs01_00016213 predicted 844
10 SASI_Hs01_00016214 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091847 predicted 858
2 SASI_Hs01_00091848 predicted 906
3 SASI_Hs01_00091849 predicted 822
4 SASI_Hs01_00091850 predicted 789
5 SASI_Hs01_00091851 predicted 909
6 SASI_Hs01_00091852 predicted 802
7 SASI_Hs01_00091853 predicted 788
8 SASI_Hs01_00091854 predicted 1291
9 SASI_Hs01_00091855 predicted 841
10 SASI_Hs01_00091856 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332865 predicted 317
2 SASI_Rn02_00332866 predicted 594
3 SASI_Rn02_00332867 predicted 221
4 SASI_Rn02_00332868 predicted 422
5 SASI_Rn02_00332869 predicted 384
6 SASI_Rn02_00332870 predicted 732
7 SASI_Rn02_00332871 predicted 857
8 SASI_Rn02_00332872 predicted 646
9 SASI_Rn02_00332873 predicted 318
10 SASI_Rn02_00332874 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187939 predicted 961
2 SASI_Mm01_00187940 predicted 788
3 SASI_Mm01_00187941 predicted 922
4 SASI_Mm01_00187942 predicted 766
5 SASI_Mm01_00187943 predicted 1921
6 SASI_Mm01_00187944 predicted 1215
7 SASI_Mm01_00187945 predicted 1148
8 SASI_Mm01_00187946 predicted 1208
9 SASI_Mm01_00187947 predicted 999
10 SASI_Mm01_00187948 predicted 1146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004978
KCNC4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shaw-related subfamily, member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004978.3-1864s21c1
Sequence:CCGGAGTGTCCGGAAAGGCACATTCCTCGAGGAATGTGCCTTTCCGGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004978.3-972s21c1
Sequence:CCGGCACGCTGGACTTCGTCAAGAACTCGAGTTCTTGACGAAGTCCAGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-246s1c1
Sequence:CCGGCGTCGGAGAAGATCATCATCACTCGAGTGATGATGATCTTCTCCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-1760s1c1
Sequence:CCGGGACTCTAAGCAGAATGGCGATCTCGAGATCGCCATTCTGCTTAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-1278s1c1
Sequence:CCGGCCAATGAGTTCCTGCTGCTTACTCGAGTAAGCAGCAGGAACTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-881s1c1
Sequence:CCGGGAGACCCATGAGGCCTTTAATCTCGAGATTAAAGGCCTCATGGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-1733s1c1
Sequence:CCGGGAGGGTATGATCGAGAGGAAACTCGAGTTTCCTCTCGATCATACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004978
KCNC4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shaw-related subfamily, member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004978.3-1864s21c1
Sequence:CCGGAGTGTCCGGAAAGGCACATTCCTCGAGGAATGTGCCTTTCCGGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004978.3-972s21c1
Sequence:CCGGCACGCTGGACTTCGTCAAGAACTCGAGTTCTTGACGAAGTCCAGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-246s1c1
Sequence:CCGGCGTCGGAGAAGATCATCATCACTCGAGTGATGATGATCTTCTCCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-1760s1c1
Sequence:CCGGGACTCTAAGCAGAATGGCGATCTCGAGATCGCCATTCTGCTTAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-1278s1c1
Sequence:CCGGCCAATGAGTTCCTGCTGCTTACTCGAGTAAGCAGCAGGAACTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-881s1c1
Sequence:CCGGGAGACCCATGAGGCCTTTAATCTCGAGATTAAAGGCCTCATGGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-1733s1c1
Sequence:CCGGGAGGGTATGATCGAGAGGAAACTCGAGTTTCCTCTCGATCATACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004978
KCNC4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shaw-related subfamily, member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004978.3-1864s21c1
Sequence:CCGGAGTGTCCGGAAAGGCACATTCCTCGAGGAATGTGCCTTTCCGGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004978.3-972s21c1
Sequence:CCGGCACGCTGGACTTCGTCAAGAACTCGAGTTCTTGACGAAGTCCAGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-246s1c1
Sequence:CCGGCGTCGGAGAAGATCATCATCACTCGAGTGATGATGATCTTCTCCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-1760s1c1
Sequence:CCGGGACTCTAAGCAGAATGGCGATCTCGAGATCGCCATTCTGCTTAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-1278s1c1
Sequence:CCGGCCAATGAGTTCCTGCTGCTTACTCGAGTAAGCAGCAGGAACTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-881s1c1
Sequence:CCGGGAGACCCATGAGGCCTTTAATCTCGAGATTAAAGGCCTCATGGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004978.2-1733s1c1
Sequence:CCGGGAGGGTATGATCGAGAGGAAACTCGAGTTTCCTCTCGATCATACCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145922
KCNC4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shaw-related subfamily, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-1433s1c1
Sequence:CCGGCGTCAATAACTTTGGTATGTACTCGAGTACATACCAAAGTTATTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-1839s1c1
Sequence:CCGGGAAGGCAATGTTGAGCCGAAACTCGAGTTTCGGCTCAACATTGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-110s1c1
Sequence:CCGGGTCGGAGAAGATCATCATCAACTCGAGTTGATGATGATCTTCTCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-1425s1c1
Sequence:CCGGCCTGTCATCGTCAATAACTTTCTCGAGAAAGTTATTGACGATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-783s1c1
Sequence:CCGGCGAAACGTGACGGAGATTCATCTCGAGATGAATCTCCGTCACGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145922
KCNC4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shaw-related subfamily, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-1433s1c1
Sequence:CCGGCGTCAATAACTTTGGTATGTACTCGAGTACATACCAAAGTTATTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-1839s1c1
Sequence:CCGGGAAGGCAATGTTGAGCCGAAACTCGAGTTTCGGCTCAACATTGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-110s1c1
Sequence:CCGGGTCGGAGAAGATCATCATCAACTCGAGTTGATGATGATCTTCTCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-1425s1c1
Sequence:CCGGCCTGTCATCGTCAATAACTTTCTCGAGAAAGTTATTGACGATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-783s1c1
Sequence:CCGGCGAAACGTGACGGAGATTCATCTCGAGATGAATCTCCGTCACGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145922
KCNC4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shaw-related subfamily, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-1433s1c1
Sequence:CCGGCGTCAATAACTTTGGTATGTACTCGAGTACATACCAAAGTTATTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-1839s1c1
Sequence:CCGGGAAGGCAATGTTGAGCCGAAACTCGAGTTTCGGCTCAACATTGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-110s1c1
Sequence:CCGGGTCGGAGAAGATCATCATCAACTCGAGTTGATGATGATCTTCTCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-1425s1c1
Sequence:CCGGCCTGTCATCGTCAATAACTTTCTCGAGAAAGTTATTGACGATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145922.1-783s1c1
Sequence:CCGGCGAAACGTGACGGAGATTCATCTCGAGATGAATCTCCGTCACGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)