EMAIL THIS PAGE TO A FRIEND

KCND1

potassium voltage-gated channel, Shal-related subfamily, member 1

132 Gene Product Result for
Synonyms: KV4.1
UniProtKB ID: Q9NSA2, B2RCG0, O75671
Gene ID:
Human(3750) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This gene is expressed at moderate levels in all tissues analyzed, with lower levels in skeletal muscle. [provided by RefSeq, Jul 2008]
Mouse(16506) potassium voltage-gated channel, Shal-related family, member 1
Rat(116695) potassium voltage-gated channel, Shal-related subfamily, member 1
Zebrafish(100001681) potassium voltage-gated channel, Shal-related subfamily, member 1
domestic cat(101098521) potassium voltage-gated channel, Shal-related subfamily, member 1
cow(518384) potassium voltage-gated channel, Shal-related subfamily, member 1
Horse(100051922) potassium voltage-gated channel, Shal-related subfamily, member 1
dog(612548) potassium voltage-gated channel, Shal-related subfamily, member 1
sheep(101106661) potassium voltage-gated channel, Shal-related subfamily, member 1
Domestic Rabbit(100008836) potassium voltage-gated channel, Shal-related subfamily, member 1
domestic guinea pig(100733079) potassium voltage-gated channel, Shal-related subfamily, member 1
naked mole-rat(101713711) potassium voltage-gated channel, Shal-related subfamily, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004979 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139131 MISSION® esiRNA esiRNA human KCND1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004979 Rosetta Predictions human pricing
NM_001105748 Rosetta Predictions rat pricing
NM_008423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118028 predicted 2301
2 SASI_Hs01_00118029 predicted 2783
3 SASI_Hs01_00118031 predicted 1676
4 SASI_Hs01_00118032 predicted 3361
5 SASI_Hs02_00338682 predicted 2862
6 SASI_Hs01_00118033 predicted 2282
7 SASI_Hs01_00118034 predicted 1789
8 SASI_Hs01_00118036 predicted 2828
9 SASI_Hs01_00118037 predicted 2877
10 SASI_Hs02_00338683 predicted 2176
11 SASI_Hs01_00118030 predicted 2713
12 SASI_Hs01_00118035 predicted 2282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212146 predicted 1290
2 SASI_Rn02_00212147 predicted 1206
3 SASI_Rn02_00212148 predicted 1217
4 SASI_Rn02_00212149 predicted 1084
5 SASI_Rn02_00212150 predicted 1930
6 SASI_Rn02_00212151 predicted 1965
7 SASI_Rn02_00212152 predicted 879
8 SASI_Rn02_00212153 predicted 1215
9 SASI_Rn02_00212154 predicted 210
10 SASI_Rn02_00212155 predicted 1927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150060 predicted 1288
2 SASI_Mm01_00150061 predicted 1082
3 SASI_Mm02_00313890 predicted 1540
4 SASI_Mm01_00150062 predicted 1207
5 SASI_Mm01_00150063 predicted 1398
6 SASI_Mm01_00150064 predicted 1377
7 SASI_Mm01_00150065 predicted 1470
8 SASI_Mm01_00150066 predicted 811
9 SASI_Mm01_00150067 predicted 216
10 SASI_Mm01_00150069 predicted 850
11 SASI_Mm01_00150068 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004979
KCND1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shal-related subfamily, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004979.3-4200s1c1
Sequence:CCGGCCTGGGATGTTTCTGAACTTTCTCGAGAAAGTTCAGAAACATCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-2015s1c1
Sequence:CCGGACTCATATTCACAGGTGAATACTCGAGTATTCACCTGTGAATATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-1445s1c1
Sequence:CCGGGCGCTTTGAGACTTGGAAGAACTCGAGTTCTTCCAAGTCTCAAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-2440s1c1
Sequence:CCGGGCACCATTGCTGGCAAGATTTCTCGAGAAATCTTGCCAGCAATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-3085s1c1
Sequence:CCGGCTGCCATTATCAGCATCCCTACTCGAGTAGGGATGCTGATAATGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004979.4-3881s21c1
Sequence:CCGGTAAGAAGGAGAGTTGAGATTTCTCGAGAAATCTCAACTCTCCTTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004979.4-3989s21c1
Sequence:CCGGTCTCCATCTGGCCCAACAATTCTCGAGAATTGTTGGGCCAGATGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004979.4-3641s21c1
Sequence:CCGGTGCAATGGAGTTTCATGAAATCTCGAGATTTCATGAAACTCCATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004979.4-1975s21c1
Sequence:CCGGAGAGTATCGGGACCGAAAGAACTCGAGTTCTTTCGGTCCCGATACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004979
KCND1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shal-related subfamily, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004979.3-4200s1c1
Sequence:CCGGCCTGGGATGTTTCTGAACTTTCTCGAGAAAGTTCAGAAACATCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-2015s1c1
Sequence:CCGGACTCATATTCACAGGTGAATACTCGAGTATTCACCTGTGAATATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-1445s1c1
Sequence:CCGGGCGCTTTGAGACTTGGAAGAACTCGAGTTCTTCCAAGTCTCAAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-2440s1c1
Sequence:CCGGGCACCATTGCTGGCAAGATTTCTCGAGAAATCTTGCCAGCAATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-3085s1c1
Sequence:CCGGCTGCCATTATCAGCATCCCTACTCGAGTAGGGATGCTGATAATGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004979.4-3881s21c1
Sequence:CCGGTAAGAAGGAGAGTTGAGATTTCTCGAGAAATCTCAACTCTCCTTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004979.4-3989s21c1
Sequence:CCGGTCTCCATCTGGCCCAACAATTCTCGAGAATTGTTGGGCCAGATGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004979.4-3641s21c1
Sequence:CCGGTGCAATGGAGTTTCATGAAATCTCGAGATTTCATGAAACTCCATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004979.4-1975s21c1
Sequence:CCGGAGAGTATCGGGACCGAAAGAACTCGAGTTCTTTCGGTCCCGATACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004979
KCND1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shal-related subfamily, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004979.3-4200s1c1
Sequence:CCGGCCTGGGATGTTTCTGAACTTTCTCGAGAAAGTTCAGAAACATCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-2015s1c1
Sequence:CCGGACTCATATTCACAGGTGAATACTCGAGTATTCACCTGTGAATATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-1445s1c1
Sequence:CCGGGCGCTTTGAGACTTGGAAGAACTCGAGTTCTTCCAAGTCTCAAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-2440s1c1
Sequence:CCGGGCACCATTGCTGGCAAGATTTCTCGAGAAATCTTGCCAGCAATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004979.3-3085s1c1
Sequence:CCGGCTGCCATTATCAGCATCCCTACTCGAGTAGGGATGCTGATAATGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004979.4-3881s21c1
Sequence:CCGGTAAGAAGGAGAGTTGAGATTTCTCGAGAAATCTCAACTCTCCTTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004979.4-3989s21c1
Sequence:CCGGTCTCCATCTGGCCCAACAATTCTCGAGAATTGTTGGGCCAGATGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004979.4-3641s21c1
Sequence:CCGGTGCAATGGAGTTTCATGAAATCTCGAGATTTCATGAAACTCCATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004979.4-1975s21c1
Sequence:CCGGAGAGTATCGGGACCGAAAGAACTCGAGTTCTTTCGGTCCCGATACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008423
KCND1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shal-related subfamily, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-1081s1c1
Sequence:CCGGGCTGCCTTCTGGTATACCATTCTCGAGAATGGTATACCAGAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-145s1c1
Sequence:CCGGCGGCGCTTTGAGACCTGGAAACTCGAGTTTCCAGGTCTCAAAGCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-1385s1c1
Sequence:CCGGACGGACAAATGCTGTGCGTTACTCGAGTAACGCACAGCATTTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-1547s1c1
Sequence:CCGGCCTCAGTATCATCCCAACCAACTCGAGTTGGTTGGGATGATACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-780s1c1
Sequence:CCGGGCGGAGTGTGATGAGCCTTATCTCGAGATAAGGCTCATCACACTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008423
KCND1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shal-related subfamily, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-1081s1c1
Sequence:CCGGGCTGCCTTCTGGTATACCATTCTCGAGAATGGTATACCAGAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-145s1c1
Sequence:CCGGCGGCGCTTTGAGACCTGGAAACTCGAGTTTCCAGGTCTCAAAGCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-1385s1c1
Sequence:CCGGACGGACAAATGCTGTGCGTTACTCGAGTAACGCACAGCATTTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-1547s1c1
Sequence:CCGGCCTCAGTATCATCCCAACCAACTCGAGTTGGTTGGGATGATACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-780s1c1
Sequence:CCGGGCGGAGTGTGATGAGCCTTATCTCGAGATAAGGCTCATCACACTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008423
KCND1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shal-related subfamily, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-1081s1c1
Sequence:CCGGGCTGCCTTCTGGTATACCATTCTCGAGAATGGTATACCAGAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-145s1c1
Sequence:CCGGCGGCGCTTTGAGACCTGGAAACTCGAGTTTCCAGGTCTCAAAGCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-1385s1c1
Sequence:CCGGACGGACAAATGCTGTGCGTTACTCGAGTAACGCACAGCATTTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-1547s1c1
Sequence:CCGGCCTCAGTATCATCCCAACCAACTCGAGTTGGTTGGGATGATACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008423.1-780s1c1
Sequence:CCGGGCGGAGTGTGATGAGCCTTATCTCGAGATAAGGCTCATCACACTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)