EMAIL THIS PAGE TO A FRIEND

KCND2

potassium voltage-gated channel, Shal-related subfamily, member 2

232 Gene Product Result for
Synonyms: KV4.2 RK5
Gene ID:
Human(3751) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
Mouse(16508) potassium voltage-gated channel, Shal-related family, member 2
Rat(65180) potassium voltage-gated channel, Shal-related subfamily, member 2
sheep(101122690) potassium voltage-gated channel, Shal-related subfamily, member 2
Domestic Rabbit(100008841) potassium voltage-gated channel, Shal-related subfamily, member 2
domestic guinea pig(100720728) potassium voltage-gated channel, Shal-related subfamily, member 2
naked mole-rat(101712898) potassium voltage-gated channel, Shal-related subfamily, member 2
Zebrafish(570188) potassium voltage-gated channel, Shal-related subfamily, member 2
cow(540416) potassium voltage-gated channel, Shal-related subfamily, member 2
dog(491424) potassium voltage-gated channel, Shal-related subfamily, member 2
domestic cat(101093262) potassium voltage-gated channel, Shal-related subfamily, member 2
chicken(374143) potassium voltage-gated channel, Shal-related subfamily, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012281 Rosetta Predictions human pricing
NM_031730 Rosetta Predictions rat pricing
NM_019697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033109 predicted 2301
2 SASI_Hs01_00033110 predicted 1574
3 SASI_Hs01_00033111 predicted 2309
4 SASI_Hs01_00033112 predicted 2435
5 SASI_Hs02_00344015 predicted 2732
6 SASI_Hs02_00344016 predicted 1672
7 SASI_Hs01_00033113 predicted 1357
8 SASI_Hs01_00033114 predicted 1976
9 SASI_Hs01_00033115 predicted 2635
10 SASI_Hs01_00033116 predicted 2650
11 SASI_Hs01_00033117 predicted 1936
12 SASI_Hs01_00033118 predicted 2595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077860 predicted 2315
2 SASI_Rn01_00077861 predicted 671
3 SASI_Rn01_00077862 predicted 2174
4 SASI_Rn01_00077863 predicted 2203
5 SASI_Rn01_00077864 predicted 1148
6 SASI_Rn01_00077865 predicted 1565
7 SASI_Rn01_00077866 predicted 2193
8 SASI_Rn02_00265111 predicted 2014
9 SASI_Rn02_00265112 predicted 2222
10 SASI_Rn01_00077868 predicted 1431
11 SASI_Rn01_00077867 predicted 2347
12 SASI_Rn01_00077869 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053540 predicted 311
2 SASI_Mm01_00053541 predicted 1178
3 SASI_Mm02_00324797 predicted 1502
4 SASI_Mm01_00053542 predicted 1203
5 SASI_Mm01_00053543 predicted 1848
6 SASI_Mm01_00053544 predicted 1445
7 SASI_Mm02_00324798 predicted 1867
8 SASI_Mm01_00053545 predicted 1651
9 SASI_Mm01_00053546 predicted 1565
10 SASI_Mm01_00053547 predicted 1935
11 SASI_Mm01_00053548 predicted 1966
12 SASI_Mm01_00053549 predicted 2118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012281
KCND2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shal-related subfamily, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012281.2-2860s21c1
Sequence:CCGGACAATTGGAATAAGGTCTAAGCTCGAGCTTAGACCTTATTCCAATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012281.2-3047s21c1
Sequence:CCGGACCTGTTATACAGAGTAATATCTCGAGATATTACTCTGTATAACAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012281.2-3255s21c1
Sequence:CCGGTTGGCTATGATGAAGATTATTCTCGAGAATAATCTTCATCATAGCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-2300s1c1
Sequence:CCGGGCAGAGCAAACGGAATGGTTTCTCGAGAAACCATTCCGTTTGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-1310s1c1
Sequence:CCGGCGATGAAGAACTGGCCTTCTTCTCGAGAAGAAGGCCAGTTCTTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-2581s1c1
Sequence:CCGGGCATCCCAAATGCCAATGTATCTCGAGATACATTGGCATTTGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-1195s1c1
Sequence:CCGGACCCAGAAACTCAGCAGTATTCTCGAGAATACTGCTGAGTTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-2473s1c1
Sequence:CCGGGCATGGAAGTTGCAACTGTTACTCGAGTAACAGTTGCAACTTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012281
KCND2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shal-related subfamily, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012281.2-2860s21c1
Sequence:CCGGACAATTGGAATAAGGTCTAAGCTCGAGCTTAGACCTTATTCCAATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012281.2-3047s21c1
Sequence:CCGGACCTGTTATACAGAGTAATATCTCGAGATATTACTCTGTATAACAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012281.2-3255s21c1
Sequence:CCGGTTGGCTATGATGAAGATTATTCTCGAGAATAATCTTCATCATAGCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-2300s1c1
Sequence:CCGGGCAGAGCAAACGGAATGGTTTCTCGAGAAACCATTCCGTTTGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-1310s1c1
Sequence:CCGGCGATGAAGAACTGGCCTTCTTCTCGAGAAGAAGGCCAGTTCTTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-2581s1c1
Sequence:CCGGGCATCCCAAATGCCAATGTATCTCGAGATACATTGGCATTTGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-1195s1c1
Sequence:CCGGACCCAGAAACTCAGCAGTATTCTCGAGAATACTGCTGAGTTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-2473s1c1
Sequence:CCGGGCATGGAAGTTGCAACTGTTACTCGAGTAACAGTTGCAACTTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012281
KCND2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shal-related subfamily, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012281.2-2860s21c1
Sequence:CCGGACAATTGGAATAAGGTCTAAGCTCGAGCTTAGACCTTATTCCAATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012281.2-3047s21c1
Sequence:CCGGACCTGTTATACAGAGTAATATCTCGAGATATTACTCTGTATAACAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012281.2-3255s21c1
Sequence:CCGGTTGGCTATGATGAAGATTATTCTCGAGAATAATCTTCATCATAGCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-2300s1c1
Sequence:CCGGGCAGAGCAAACGGAATGGTTTCTCGAGAAACCATTCCGTTTGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-1310s1c1
Sequence:CCGGCGATGAAGAACTGGCCTTCTTCTCGAGAAGAAGGCCAGTTCTTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-2581s1c1
Sequence:CCGGGCATCCCAAATGCCAATGTATCTCGAGATACATTGGCATTTGGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-1195s1c1
Sequence:CCGGACCCAGAAACTCAGCAGTATTCTCGAGAATACTGCTGAGTTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012281.2-2473s1c1
Sequence:CCGGGCATGGAAGTTGCAACTGTTACTCGAGTAACAGTTGCAACTTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019697
KCND2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shal-related subfamily, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-2830s1c1
Sequence:CCGGCCTGAGTATTCGGGAGGAAATCTCGAGATTTCCTCCCGAATACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-2633s1c1
Sequence:CCGGGCAGTGTGCAAGAACTCAGTACTCGAGTACTGAGTTCTTGCACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-1371s1c1
Sequence:CCGGCGACTGCTGTTATGAGGAGTACTCGAGTACTCCTCATAACAGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-2452s1c1
Sequence:CCGGCATGAGTTTGTCGATGAACAACTCGAGTTGTTCATCGACAAACTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-1755s1c1
Sequence:CCGGGCGCAGTGTCATGAGTATCATCTCGAGATGATACTCATGACACTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019697
KCND2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shal-related subfamily, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-2830s1c1
Sequence:CCGGCCTGAGTATTCGGGAGGAAATCTCGAGATTTCCTCCCGAATACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-2633s1c1
Sequence:CCGGGCAGTGTGCAAGAACTCAGTACTCGAGTACTGAGTTCTTGCACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-1371s1c1
Sequence:CCGGCGACTGCTGTTATGAGGAGTACTCGAGTACTCCTCATAACAGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-2452s1c1
Sequence:CCGGCATGAGTTTGTCGATGAACAACTCGAGTTGTTCATCGACAAACTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-1755s1c1
Sequence:CCGGGCGCAGTGTCATGAGTATCATCTCGAGATGATACTCATGACACTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019697
KCND2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shal-related subfamily, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-2830s1c1
Sequence:CCGGCCTGAGTATTCGGGAGGAAATCTCGAGATTTCCTCCCGAATACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-2633s1c1
Sequence:CCGGGCAGTGTGCAAGAACTCAGTACTCGAGTACTGAGTTCTTGCACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-1371s1c1
Sequence:CCGGCGACTGCTGTTATGAGGAGTACTCGAGTACTCCTCATAACAGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-2452s1c1
Sequence:CCGGCATGAGTTTGTCGATGAACAACTCGAGTTGTTCATCGACAAACTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019697.2-1755s1c1
Sequence:CCGGGCGCAGTGTCATGAGTATCATCTCGAGATGATACTCATGACACTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)