EMAIL THIS PAGE TO A FRIEND

KCND3

potassium voltage-gated channel, Shal-related subfamily, member 3

104 Gene Product Result for
Synonyms: KCND3L KCND3S KSHIVB KV4.3
Gene ID:
Human(3752) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
Mouse(56543) potassium voltage-gated channel, Shal-related family, member 3
Rat(65195) potassium voltage-gated channel, Shal-related subfamily, member 3
Zebrafish(327415) potassium voltage-gated channel, Shal-related subfamily, member 3
cow(539739) potassium voltage-gated channel, Shal-related subfamily, member 3
Horse(100058973) potassium voltage-gated channel, Shal-related subfamily, member 3
domestic cat(101095595) potassium voltage-gated channel, Shal-related subfamily, member 3
dog(403758) potassium voltage-gated channel, Shal-related subfamily, member 3
chicken(374228) potassium voltage-gated channel, Shal-related subfamily, member 3
domestic guinea pig(100714167) potassium voltage-gated channel, Shal-related subfamily, member 3
naked mole-rat(101700308) potassium voltage-gated channel, Shal-related subfamily, member 3
sheep(101115919) potassium voltage-gated channel, Shal-related subfamily, member 3
Domestic Rabbit(100009472) potassium voltage-gated channel, Shal-related subfamily, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
D7148 3,4-Diaminopyridine ≥98% human pricing
36687 4-Aminopyridine PESTANAL®, analytical standard human pricing
1162454 Dalfampridine United States Pharmacopeia (USP) Reference Standard human pricing
PH016683 Guanidine AldrichCPR human pricing
G11659 Guanidine carbonate salt 99% human pricing
50930 Guanidine carbonate salt purum, ≥97.0% (NT) human pricing
G3272 Guanidine hydrochloride for molecular biology, ≥99% human pricing
G4505 Guanidine hydrochloride organic base and chaeotropic agent, ≥99% (titration) human pricing
50950 Guanidine hydrochloride ≥98% human pricing
PHG0006 Guanidine hydrochloride PharmaGrade, Manufactured under appropriate controls for use as a raw material in pharma or biopharmaceutical production. human pricing
50933 Guanidine hydrochloride BioUltra, for molecular biology, ≥99.5% (AT) human pricing
RDD001 Guanidine hydrochloride anhydrous, free-flowing, Redi-Dri, ≥99% human pricing
50940 Guanidine hydrochloride ≥99.0% (AT) human pricing
V900385 Guanidine hydrochloride Vetec reagent grade, ≥98% human pricing
12-1660 Guanidine hydrochloride SAJ special grade, ≥99.0% human pricing
12-1665 Guanidine hydrochloride ≥99.5% human pricing
G11705 Guanidine hydrochloride 92% human pricing
G7153 Guanidine hydrochloride BioXtra, ≥99.5% (titration) human pricing
G4630 Guanidine hydrochloride ≥98% human pricing
G9284 Guanidine hydrochloride solution human pricing
50937 Guanidine hydrochloride solution BioUltra, ~8 M in H2O human pricing
275875 4-Aminopyridine ≥99% human, mouse, rat pricing
A78403 4-Aminopyridine 98% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004980 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003811 MISSION® esiRNA esiRNA targeting mouse Kcnd3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004980 Rosetta Predictions human pricing
NM_172198 Rosetta Predictions human pricing
NM_031739 Rosetta Predictions rat pricing
NM_001039347 Rosetta Predictions mouse pricing
NM_019931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022084 predicted 951
2 SASI_Hs01_00022085 predicted 2421
3 SASI_Hs01_00022088 predicted 1695
4 SASI_Hs01_00022089 predicted 2388
5 SASI_Hs01_00022090 predicted 1601
6 SASI_Hs01_00022091 predicted 685
7 SASI_Hs01_00022092 predicted 1240
8 SASI_Hs01_00022093 predicted 1585
9 SASI_Hs02_00338684 predicted 1040
10 SASI_Hs02_00338685 predicted 1233
11 SASI_Hs01_00022086 predicted 2282
12 SASI_Hs01_00022087 predicted 1716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035445 predicted 949
2 SASI_Hs01_00035446 predicted 2368
3 SASI_Hs01_00035449 predicted 1694
4 SASI_Hs01_00035450 predicted 2337
5 SASI_Hs01_00035451 predicted 1596
6 SASI_Hs01_00035452 predicted 678
7 SASI_Hs01_00035453 predicted 1241
8 SASI_Hs01_00035454 predicted 1590
9 SASI_Hs02_00367900 predicted 1045
10 SASI_Hs02_00367901 predicted 1235
11 SASI_Hs01_00035447 predicted 2224
12 SASI_Hs01_00035448 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094858 predicted 1334
2 SASI_Rn01_00094859 predicted 484
3 SASI_Rn02_00265124 predicted 1039
4 SASI_Rn02_00265125 predicted 206
5 SASI_Rn01_00094861 predicted 1548
6 SASI_Rn02_00265126 predicted 1915
7 SASI_Rn02_00265127 predicted 290
8 SASI_Rn01_00094862 predicted 1212
9 SASI_Rn01_00094863 predicted 1426
10 SASI_Rn01_00094865 predicted 860
11 SASI_Rn01_00094857 predicted 337
12 SASI_Rn01_00094860 predicted 1261
13 SASI_Rn01_00094864 predicted 1268
14 SASI_Rn01_00094866 predicted 1779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022257 predicted 1662
2 SASI_Mm01_00022258 predicted 670
3 SASI_Mm02_00290013 predicted 1585
4 SASI_Mm01_00022259 predicted 735
5 SASI_Mm01_00022260 predicted 736
6 SASI_Mm01_00022261 predicted 1525
7 SASI_Mm01_00022262 predicted 1665
8 SASI_Mm01_00022263 predicted 1125
9 SASI_Mm01_00022264 predicted 1583
10 SASI_Mm01_00022265 predicted 1666
11 SASI_Mm01_00022256 predicted 1703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147081 predicted 1195
2 SASI_Mm01_00147082 predicted 197
3 SASI_Mm02_00325213 predicted 1123
4 SASI_Mm01_00147083 predicted 272
5 SASI_Mm01_00147084 predicted 268
6 SASI_Mm01_00147085 predicted 1064
7 SASI_Mm01_00147086 predicted 1199
8 SASI_Mm01_00147087 predicted 657
9 SASI_Mm01_00147088 predicted 1120
10 SASI_Mm01_00147089 predicted 1205
11 SASI_Mm01_00147080 predicted 1238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004980
KCND3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shal-related subfamily, member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-1967s1c1
Sequence:CCGGCCCTGTTATCTGTACGAACCTCTCGAGAGGTTCGTACAGATAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-2417s1c1
Sequence:CCGGCCAGCAATGTTGTCAAGGTCTCTCGAGAGACCTTGACAACATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-2125s1c1
Sequence:CCGGCGTCGTAGTAAGAAGACCACACTCGAGTGTGGTCTTCTTACTACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-927s1c1
Sequence:CCGGCGACAACGACTCGGAGAACAACTCGAGTTGTTCTCCGAGTCGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-1713s1c1
Sequence:CCGGCCAGAATCAGAGAGCTGATAACTCGAGTTATCAGCTCTCTGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004980.3-1689s21c1
Sequence:CCGGTTCCAACTTTAGCCGGATTTACTCGAGTAAATCCGGCTAAAGTTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004980.3-1936s21c1
Sequence:CCGGACCACTGGGTTGTCCTATCTTCTCGAGAAGATAGGACAACCCAGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004980
KCND3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shal-related subfamily, member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-1967s1c1
Sequence:CCGGCCCTGTTATCTGTACGAACCTCTCGAGAGGTTCGTACAGATAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-2417s1c1
Sequence:CCGGCCAGCAATGTTGTCAAGGTCTCTCGAGAGACCTTGACAACATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-2125s1c1
Sequence:CCGGCGTCGTAGTAAGAAGACCACACTCGAGTGTGGTCTTCTTACTACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-927s1c1
Sequence:CCGGCGACAACGACTCGGAGAACAACTCGAGTTGTTCTCCGAGTCGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-1713s1c1
Sequence:CCGGCCAGAATCAGAGAGCTGATAACTCGAGTTATCAGCTCTCTGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004980.3-1689s21c1
Sequence:CCGGTTCCAACTTTAGCCGGATTTACTCGAGTAAATCCGGCTAAAGTTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004980.3-1936s21c1
Sequence:CCGGACCACTGGGTTGTCCTATCTTCTCGAGAAGATAGGACAACCCAGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004980
KCND3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shal-related subfamily, member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-1967s1c1
Sequence:CCGGCCCTGTTATCTGTACGAACCTCTCGAGAGGTTCGTACAGATAACAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-2417s1c1
Sequence:CCGGCCAGCAATGTTGTCAAGGTCTCTCGAGAGACCTTGACAACATTGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-2125s1c1
Sequence:CCGGCGTCGTAGTAAGAAGACCACACTCGAGTGTGGTCTTCTTACTACGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-927s1c1
Sequence:CCGGCGACAACGACTCGGAGAACAACTCGAGTTGTTCTCCGAGTCGTTGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004980.3-1713s1c1
Sequence:CCGGCCAGAATCAGAGAGCTGATAACTCGAGTTATCAGCTCTCTGATTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004980.3-1689s21c1
Sequence:CCGGTTCCAACTTTAGCCGGATTTACTCGAGTAAATCCGGCTAAAGTTGGAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004980.3-1936s21c1
Sequence:CCGGACCACTGGGTTGTCCTATCTTCTCGAGAAGATAGGACAACCCAGTGGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019931
KCND3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Shal-related subfamily, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-1066s1c1
Sequence:CCGGGCATCTTTCTGGTACACCATACTCGAGTATGGTGTACCAGAAAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-1233s1c1
Sequence:CCGGCCAGAATCAGAGAGCAGATAACTCGAGTTATCTGCTCTCTGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-876s1c1
Sequence:CCGGCCGTGTCTTCAGGATCTTCAACTCGAGTTGAAGATCCTGAAGACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-1198s1c1
Sequence:CCGGCCTGTGATAGTCTCCAACTTTCTCGAGAAAGTTGGAGACTATCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-94s1c1
Sequence:CCGGGCGGACAAGAACAAGCGGCAACTCGAGTTGCCGCTTGTTCTTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019931
KCND3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Shal-related subfamily, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-1066s1c1
Sequence:CCGGGCATCTTTCTGGTACACCATACTCGAGTATGGTGTACCAGAAAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-1233s1c1
Sequence:CCGGCCAGAATCAGAGAGCAGATAACTCGAGTTATCTGCTCTCTGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-876s1c1
Sequence:CCGGCCGTGTCTTCAGGATCTTCAACTCGAGTTGAAGATCCTGAAGACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-1198s1c1
Sequence:CCGGCCTGTGATAGTCTCCAACTTTCTCGAGAAAGTTGGAGACTATCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-94s1c1
Sequence:CCGGGCGGACAAGAACAAGCGGCAACTCGAGTTGCCGCTTGTTCTTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019931
KCND3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Shal-related subfamily, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-1066s1c1
Sequence:CCGGGCATCTTTCTGGTACACCATACTCGAGTATGGTGTACCAGAAAGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-1233s1c1
Sequence:CCGGCCAGAATCAGAGAGCAGATAACTCGAGTTATCTGCTCTCTGATTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-876s1c1
Sequence:CCGGCCGTGTCTTCAGGATCTTCAACTCGAGTTGAAGATCCTGAAGACACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-1198s1c1
Sequence:CCGGCCTGTGATAGTCTCCAACTTTCTCGAGAAAGTTGGAGACTATCACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019931.1-94s1c1
Sequence:CCGGGCGGACAAGAACAAGCGGCAACTCGAGTTGCCGCTTGTTCTTGTCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???