EMAIL THIS PAGE TO A FRIEND

KCNE1L

KCNE1-like

120 Gene Product Result for
Synonyms: KCNE5
UniProtKB ID: Q9UJ90
Gene ID:
Human(23630) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a membrane protein which has sequence similarity to the KCNE1 gene product, a member of the potassium channel, voltage-gated, isk-related subfamily. This intronless gene is deleted in AMME contiguous gene syndrome and may be involved in the cardiac and neurologic abnormalities found in the AMME contiguous gene syndrome. [provided by RefSeq, Jul 2008]
Mouse(66240) potassium voltage-gated channel, Isk-related family, member 1-like, pseudogene
Rat(681190) KCNE1-like
sheep(101114087) KCNE1-like
cow(508071) KCNE1-like
dog(610432) KCNE1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012282 Rosetta Predictions human pricing
NM_001101003 Rosetta Predictions rat pricing
NM_021487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088138 predicted 903
2 SASI_Hs01_00088139 predicted 798
3 SASI_Hs01_00088140 predicted 906
4 SASI_Hs01_00088141 predicted 666
5 SASI_Hs02_00344017 predicted 797
6 SASI_Hs01_00088142 predicted 741
7 SASI_Hs01_00088143 predicted 805
8 SASI_Hs01_00088144 predicted 1066
9 SASI_Hs01_00088145 predicted 382
10 SASI_Hs02_00344018 predicted 378
11 SASI_Hs01_00088146 predicted 890
12 SASI_Hs01_00088147 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211156 predicted 220
2 SASI_Rn02_00211157 predicted 231
3 SASI_Rn02_00211158 predicted 388
4 SASI_Rn02_00211159 predicted 251
5 SASI_Rn02_00211160 predicted 224
6 SASI_Rn02_00211161 predicted 213
7 SASI_Rn02_00211162 predicted 231
8 SASI_Rn02_00211163 predicted 212
9 SASI_Rn02_00211164 predicted 254
10 SASI_Rn02_00211165 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142317 predicted 802
2 SASI_Mm01_00142318 predicted 810
3 SASI_Mm01_00142323 predicted 1087
4 SASI_Mm01_00142325 predicted 869
5 SASI_Mm01_00142326 predicted 994
6 SASI_Mm02_00326177 predicted 908
7 SASI_Mm02_00326178 predicted 808
8 SASI_Mm02_00326179 predicted 836
9 SASI_Mm02_00326180 predicted 1085
10 SASI_Mm01_00142319 predicted 512
11 SASI_Mm01_00142320 predicted 340
12 SASI_Mm01_00142321 predicted 339
13 SASI_Mm01_00142322 predicted 352
14 SASI_Mm01_00142324 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012282
KCNE1L MISSION shRNA Bacterial Glycerol Stock
KCNE1-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-1130s1c1
Sequence:CCGGGACCAGTCTGTGGGATAGAATCTCGAGATTCTATCCCACAGACTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-1201s1c1
Sequence:CCGGGATCTATGACTCCAACCGTATCTCGAGATACGGTTGGAGTCATAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-1296s1c1
Sequence:CCGGGATTACCATTACTGGGTGTATCTCGAGATACACCCAGTAATGGTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012282.2-321s1c1
Sequence:CCGGCTATCTCTACATCCTGCTCATCTCGAGATGAGCAGGATGTAGAGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-799s1c1
Sequence:CCGGCGCACATCCAACTGCACTAAACTCGAGTTTAGTGCAGTTGGATGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012282.2-312s21c1
Sequence:CCGGCGACGACGCCTATCTCTACATCTCGAGATGTAGAGATAGGCGTCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012282.2-910s21c1
Sequence:CCGGACTGAAGCAATGCATTCTATCCTCGAGGATAGAATGCATTGCTTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012282.2-929s21c1
Sequence:CCGGTCAGAACTCTGGGCCGTCTAACTCGAGTTAGACGGCCCAGAGTTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012282
KCNE1L MISSION shRNA shRNA Plasmid DNA
KCNE1-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-1130s1c1
Sequence:CCGGGACCAGTCTGTGGGATAGAATCTCGAGATTCTATCCCACAGACTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-1201s1c1
Sequence:CCGGGATCTATGACTCCAACCGTATCTCGAGATACGGTTGGAGTCATAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-1296s1c1
Sequence:CCGGGATTACCATTACTGGGTGTATCTCGAGATACACCCAGTAATGGTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012282.2-321s1c1
Sequence:CCGGCTATCTCTACATCCTGCTCATCTCGAGATGAGCAGGATGTAGAGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-799s1c1
Sequence:CCGGCGCACATCCAACTGCACTAAACTCGAGTTTAGTGCAGTTGGATGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012282.2-312s21c1
Sequence:CCGGCGACGACGCCTATCTCTACATCTCGAGATGTAGAGATAGGCGTCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012282.2-910s21c1
Sequence:CCGGACTGAAGCAATGCATTCTATCCTCGAGGATAGAATGCATTGCTTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012282.2-929s21c1
Sequence:CCGGTCAGAACTCTGGGCCGTCTAACTCGAGTTAGACGGCCCAGAGTTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012282
KCNE1L MISSION shRNA Lentiviral Transduction Particles
KCNE1-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-1130s1c1
Sequence:CCGGGACCAGTCTGTGGGATAGAATCTCGAGATTCTATCCCACAGACTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-1201s1c1
Sequence:CCGGGATCTATGACTCCAACCGTATCTCGAGATACGGTTGGAGTCATAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-1296s1c1
Sequence:CCGGGATTACCATTACTGGGTGTATCTCGAGATACACCCAGTAATGGTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012282.2-321s1c1
Sequence:CCGGCTATCTCTACATCCTGCTCATCTCGAGATGAGCAGGATGTAGAGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012282.2-799s1c1
Sequence:CCGGCGCACATCCAACTGCACTAAACTCGAGTTTAGTGCAGTTGGATGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012282.2-312s21c1
Sequence:CCGGCGACGACGCCTATCTCTACATCTCGAGATGTAGAGATAGGCGTCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012282.2-910s21c1
Sequence:CCGGACTGAAGCAATGCATTCTATCCTCGAGGATAGAATGCATTGCTTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012282.2-929s21c1
Sequence:CCGGTCAGAACTCTGGGCCGTCTAACTCGAGTTAGACGGCCCAGAGTTCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021487
KCNE1L MISSION shRNA Bacterial Glycerol Stock
KCNE1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-333s1c1
Sequence:CCGGGCCAAGGGTAACGACGCTTATCTCGAGATAAGCGTCGTTACCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-363s1c1
Sequence:CCGGCTACTCATCATGATCTTCTATCTCGAGATAGAAGATCATGATGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-200s1c1
Sequence:CCGGGCAAACCCTCTTGAACCGCTTCTCGAGAAGCGGTTCAAGAGGGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-512s1c1
Sequence:CCGGCCCGGAGAATGGCCAGGGCTTCTCGAGAAGCCCTGGCCATTCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-345s1c1
Sequence:CCGGGACGCTTATCTCTACATCCTACTCGAGTAGGATGTAGAGATAAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021487
KCNE1L MISSION shRNA shRNA Plasmid DNA
KCNE1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-333s1c1
Sequence:CCGGGCCAAGGGTAACGACGCTTATCTCGAGATAAGCGTCGTTACCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-363s1c1
Sequence:CCGGCTACTCATCATGATCTTCTATCTCGAGATAGAAGATCATGATGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-200s1c1
Sequence:CCGGGCAAACCCTCTTGAACCGCTTCTCGAGAAGCGGTTCAAGAGGGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-512s1c1
Sequence:CCGGCCCGGAGAATGGCCAGGGCTTCTCGAGAAGCCCTGGCCATTCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-345s1c1
Sequence:CCGGGACGCTTATCTCTACATCCTACTCGAGTAGGATGTAGAGATAAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021487
KCNE1L MISSION shRNA Lentiviral Transduction Particles
KCNE1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-333s1c1
Sequence:CCGGGCCAAGGGTAACGACGCTTATCTCGAGATAAGCGTCGTTACCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-363s1c1
Sequence:CCGGCTACTCATCATGATCTTCTATCTCGAGATAGAAGATCATGATGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-200s1c1
Sequence:CCGGGCAAACCCTCTTGAACCGCTTCTCGAGAAGCGGTTCAAGAGGGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-512s1c1
Sequence:CCGGCCCGGAGAATGGCCAGGGCTTCTCGAGAAGCCCTGGCCATTCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021487.1-345s1c1
Sequence:CCGGGACGCTTATCTCTACATCCTACTCGAGTAGGATGTAGAGATAAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)