EMAIL THIS PAGE TO A FRIEND

KCNE2

potassium voltage-gated channel, Isk-related family, member 2

77 Gene Product Result for
Synonyms: ATFB4 LQT5 LQT6 MIRP1
UniProtKB ID: Q9Y6J6, A5H1P3, D3DSF8, Q52LJ5
Gene ID:
Human(9992) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a small integral membrane subunit that assembles with the KCNH2 gene product, a pore-forming protein, to alter its function. This gene is expressed in heart and muscle and the gene mutations are associated with cardiac arrhythmia. [provided by RefSeq, Jul 2008]
Mouse(246133) potassium voltage-gated channel, Isk-related subfamily, gene 2
Rat(171138) potassium voltage-gated channel, Isk-related family, member 2
chicken(427979) potassium voltage-gated channel, Isk-related family, member 2
cow(768025) potassium voltage-gated channel, Isk-related family, member 2
domestic cat(101086335) potassium voltage-gated channel, Isk-related family, member 2
dog(403471) potassium voltage-gated channel, Isk-related family, member 2
sheep(101119863) potassium voltage-gated channel, Isk-related family, member 2
Domestic Rabbit(100008804) potassium voltage-gated channel, Isk-related family, member 2
domestic guinea pig(100725255) potassium voltage-gated channel, Isk-related family, member 2
domestic guinea pig(100135465) potassium voltage-gated channel, Isk-related subfamily, gene 2
naked mole-rat(101702275) potassium voltage-gated channel, Isk-related family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172201 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134110 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134110 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134110 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172201 Rosetta Predictions human pricing
NM_133603 Rosetta Predictions rat pricing
NM_134110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210319 predicted 425
2 SASI_Hs01_00210320 predicted 517
3 SASI_Hs01_00210321 predicted 263
4 SASI_Hs01_00210322 predicted 427
5 SASI_Hs01_00210323 predicted 210
6 SASI_Hs01_00210324 predicted 383
7 SASI_Hs01_00210325 predicted 297
8 SASI_Hs01_00210326 predicted 574
9 SASI_Hs02_00367904 predicted 547
10 SASI_Hs01_00210327 predicted 219
11 SASI_Hs01_00210328 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102746 predicted 764
2 SASI_Rn01_00102748 predicted 322
3 SASI_Rn01_00102749 predicted 314
4 SASI_Rn01_00102750 predicted 973
5 SASI_Rn01_00102751 predicted 461
6 SASI_Rn01_00102752 predicted 833
7 SASI_Rn01_00102753 predicted 1057
8 SASI_Rn01_00102754 predicted 753
9 SASI_Rn01_00102755 predicted 856
10 SASI_Rn02_00267825 predicted 844
11 SASI_Rn01_00102747 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101186 predicted 865
2 SASI_Mm01_00101187 predicted 702
3 SASI_Mm01_00101189 predicted 706
4 SASI_Mm01_00101190 predicted 818
5 SASI_Mm01_00101191 predicted 267
6 SASI_Mm01_00101192 predicted 674
7 SASI_Mm01_00101193 predicted 866
8 SASI_Mm01_00101194 predicted 267
9 SASI_Mm02_00339340 predicted 803
10 SASI_Mm01_00101195 predicted 1004
11 SASI_Mm01_00101188 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172201
VALIDATED
KCNE2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Isk-related family, member 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172201.1-568s21c1
Sequence:CCGGTGCCACGAGGCAAATCCAAATCTCGAGATTTGGATTTGCCTCGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-463s21c1
Sequence:CCGGCCACCATCCATGAGAACATTGCTCGAGCAATGTTCTCATGGATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-512s21c1
Sequence:CCGGATAAGGGAGAAAGGCACCAAGCTCGAGCTTGGTGCCTTTCTCCCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-206s21c1
Sequence:CCGGTATGGACAATTGGCGCCAGAACTCGAGTTCTGGCGCCAATTGTCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-306s21c1
Sequence:CCGGATGATTGGAATGTTCTCTTTCCTCGAGGAAAGAGAACATTCCAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-264s21c1
Sequence:CCGGGATGCTGAGAACTTCTACTATCTCGAGATAGTAGAAGTTCTCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-392s1c1
Sequence:CCGGCCACCAGTACATTGTAGAGGACTCGAGTCCTCTACAATGTACTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-449s1c1
Sequence:CCGGAGAAGAATCGAAGGCCACCATCTCGAGATGGTGGCCTTCGATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-291s1c1
Sequence:CCGGCTGTACCTCATGGTGATGATTCTCGAGAATCATCACCATGAGGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-275s1c1
Sequence:CCGGCTTCTACTATGTCATCCTGTACTCGAGTACAGGATGACATAGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-174s1c1
Sequence:CCGGGAAGACGTCTTCCGAAGGATTCTCGAGAATCCTTCGGAAGACGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-430s21c1
Sequence:CCGGAGAGCCAAATCTTGAATCTAGCTCGAGCTAGATTCAAGATTTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_172201.1-480s21c1
Sequence:CCGGATTGGTGCGGCTGGGTTCAAACTCGAGTTTGAACCCAGCCGCACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_172201.1-616s21c1
Sequence:CCGGCTTGCTCTCTGTTGAGAATTTCTCGAGAAATTCTCAACAGAGAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-347s21c1
Sequence:CCGGGAGCACTGTGAAATCCAAGAGCTCGAGCTCTTGGATTTCACAGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172201
VALIDATED
KCNE2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Isk-related family, member 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172201.1-568s21c1
Sequence:CCGGTGCCACGAGGCAAATCCAAATCTCGAGATTTGGATTTGCCTCGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-463s21c1
Sequence:CCGGCCACCATCCATGAGAACATTGCTCGAGCAATGTTCTCATGGATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-512s21c1
Sequence:CCGGATAAGGGAGAAAGGCACCAAGCTCGAGCTTGGTGCCTTTCTCCCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-206s21c1
Sequence:CCGGTATGGACAATTGGCGCCAGAACTCGAGTTCTGGCGCCAATTGTCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-306s21c1
Sequence:CCGGATGATTGGAATGTTCTCTTTCCTCGAGGAAAGAGAACATTCCAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-264s21c1
Sequence:CCGGGATGCTGAGAACTTCTACTATCTCGAGATAGTAGAAGTTCTCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-392s1c1
Sequence:CCGGCCACCAGTACATTGTAGAGGACTCGAGTCCTCTACAATGTACTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-449s1c1
Sequence:CCGGAGAAGAATCGAAGGCCACCATCTCGAGATGGTGGCCTTCGATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-291s1c1
Sequence:CCGGCTGTACCTCATGGTGATGATTCTCGAGAATCATCACCATGAGGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-275s1c1
Sequence:CCGGCTTCTACTATGTCATCCTGTACTCGAGTACAGGATGACATAGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-174s1c1
Sequence:CCGGGAAGACGTCTTCCGAAGGATTCTCGAGAATCCTTCGGAAGACGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-430s21c1
Sequence:CCGGAGAGCCAAATCTTGAATCTAGCTCGAGCTAGATTCAAGATTTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_172201.1-480s21c1
Sequence:CCGGATTGGTGCGGCTGGGTTCAAACTCGAGTTTGAACCCAGCCGCACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_172201.1-616s21c1
Sequence:CCGGCTTGCTCTCTGTTGAGAATTTCTCGAGAAATTCTCAACAGAGAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-347s21c1
Sequence:CCGGGAGCACTGTGAAATCCAAGAGCTCGAGCTCTTGGATTTCACAGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172201
VALIDATED
KCNE2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Isk-related family, member 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172201.1-568s21c1
Sequence:CCGGTGCCACGAGGCAAATCCAAATCTCGAGATTTGGATTTGCCTCGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-463s21c1
Sequence:CCGGCCACCATCCATGAGAACATTGCTCGAGCAATGTTCTCATGGATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-512s21c1
Sequence:CCGGATAAGGGAGAAAGGCACCAAGCTCGAGCTTGGTGCCTTTCTCCCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-206s21c1
Sequence:CCGGTATGGACAATTGGCGCCAGAACTCGAGTTCTGGCGCCAATTGTCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-306s21c1
Sequence:CCGGATGATTGGAATGTTCTCTTTCCTCGAGGAAAGAGAACATTCCAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-264s21c1
Sequence:CCGGGATGCTGAGAACTTCTACTATCTCGAGATAGTAGAAGTTCTCAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-392s1c1
Sequence:CCGGCCACCAGTACATTGTAGAGGACTCGAGTCCTCTACAATGTACTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-449s1c1
Sequence:CCGGAGAAGAATCGAAGGCCACCATCTCGAGATGGTGGCCTTCGATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-291s1c1
Sequence:CCGGCTGTACCTCATGGTGATGATTCTCGAGAATCATCACCATGAGGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-275s1c1
Sequence:CCGGCTTCTACTATGTCATCCTGTACTCGAGTACAGGATGACATAGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172201.1-174s1c1
Sequence:CCGGGAAGACGTCTTCCGAAGGATTCTCGAGAATCCTTCGGAAGACGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-430s21c1
Sequence:CCGGAGAGCCAAATCTTGAATCTAGCTCGAGCTAGATTCAAGATTTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_172201.1-480s21c1
Sequence:CCGGATTGGTGCGGCTGGGTTCAAACTCGAGTTTGAACCCAGCCGCACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_172201.1-616s21c1
Sequence:CCGGCTTGCTCTCTGTTGAGAATTTCTCGAGAAATTCTCAACAGAGAGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172201.1-347s21c1
Sequence:CCGGGAGCACTGTGAAATCCAAGAGCTCGAGCTCTTGGATTTCACAGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134110
KCNE2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Isk-related family, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-411s1c1
Sequence:CCGGTCGTGGAAGATTGGCAGGAAACTCGAGTTTCCTGCCAATCTTCCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-316s1c1
Sequence:CCGGGATCGGCATGTTCTCGTTCATCTCGAGATGAACGAGAACATGCCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134110.1-1371s1c1
Sequence:CCGGGCTGGAGAGATGTTGGTCAAACTCGAGTTTGACCAACATCTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-298s1c1
Sequence:CCGGCCTGTACCTCATGGTGATGATCTCGAGATCATCACCATGAGGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-277s1c1
Sequence:CCGGCGAGAACTTCTACTACGTCATCTCGAGATGACGTAGTAGAAGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134110
KCNE2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Isk-related family, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-411s1c1
Sequence:CCGGTCGTGGAAGATTGGCAGGAAACTCGAGTTTCCTGCCAATCTTCCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-316s1c1
Sequence:CCGGGATCGGCATGTTCTCGTTCATCTCGAGATGAACGAGAACATGCCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134110.1-1371s1c1
Sequence:CCGGGCTGGAGAGATGTTGGTCAAACTCGAGTTTGACCAACATCTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-298s1c1
Sequence:CCGGCCTGTACCTCATGGTGATGATCTCGAGATCATCACCATGAGGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-277s1c1
Sequence:CCGGCGAGAACTTCTACTACGTCATCTCGAGATGACGTAGTAGAAGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134110
KCNE2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Isk-related family, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-411s1c1
Sequence:CCGGTCGTGGAAGATTGGCAGGAAACTCGAGTTTCCTGCCAATCTTCCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-316s1c1
Sequence:CCGGGATCGGCATGTTCTCGTTCATCTCGAGATGAACGAGAACATGCCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134110.1-1371s1c1
Sequence:CCGGGCTGGAGAGATGTTGGTCAAACTCGAGTTTGACCAACATCTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-298s1c1
Sequence:CCGGCCTGTACCTCATGGTGATGATCTCGAGATCATCACCATGAGGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134110.1-277s1c1
Sequence:CCGGCGAGAACTTCTACTACGTCATCTCGAGATGACGTAGTAGAAGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)