EMAIL THIS PAGE TO A FRIEND

KCNE3

potassium voltage-gated channel, Isk-related family, member 3

105 Gene Product Result for
Synonyms: HOKPP HYPP MiRP2
UniProtKB ID: Q9Y6H6
Gene ID:
Human(10008) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a type I membrane protein, and a beta subunit that assembles with a potassium channel alpha-subunit to modulate the gating kinetics and enhance stability of the multimeric complex. This gene is prominently expressed in the kidney. A missense mutation in this gene is associated with hypokalemic periodic paralysis. [provided by RefSeq, Jul 2008]
Mouse(57442) potassium voltage-gated channel, Isk-related subfamily, gene 3
Rat(63883) potassium voltage-gated channel, Isk-related family, member 3
domestic guinea pig(100719841) potassium voltage-gated channel, Isk-related family, member 3
naked mole-rat(101710164) potassium voltage-gated channel, Isk-related family, member 3
sheep(101106359) potassium voltage-gated channel, Isk-related family, member 3
chicken(428105) potassium voltage-gated channel, Isk-related family, member 3
domestic cat(101094205) potassium voltage-gated channel, Isk-related family, member 3
cow(527762) potassium voltage-gated channel, Isk-related family, member 3
dog(485197) potassium voltage-gated channel, Isk-related family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005472 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003431 MISSION® esiRNA esiRNA targeting human KCNE3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005472 Rosetta Predictions human pricing
NM_022235 Rosetta Predictions rat pricing
NM_020574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019043 predicted 776
2 SASI_Hs02_00339648 predicted 535
3 SASI_Hs02_00339649 predicted 743
4 SASI_Hs01_00019045 predicted 497
5 SASI_Hs01_00019046 predicted 725
6 SASI_Hs01_00019047 predicted 456
7 SASI_Hs01_00019048 predicted 398
8 SASI_Hs01_00019050 predicted 485
9 SASI_Hs02_00339650 predicted 933
10 SASI_Hs01_00019051 predicted 641
11 SASI_Hs01_00019042 predicted 858
12 SASI_Hs01_00019044 predicted 764
13 SASI_Hs01_00019049 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064822 predicted 902
2 SASI_Rn02_00263008 predicted 783
3 SASI_Rn01_00064824 predicted 271
4 SASI_Rn01_00064825 predicted 451
5 SASI_Rn01_00064826 predicted 373
6 SASI_Rn01_00064828 predicted 764
7 SASI_Rn01_00064829 predicted 480
8 SASI_Rn01_00064830 predicted 429
9 SASI_Rn01_00064831 predicted 795
10 SASI_Rn02_00263009 predicted 580
11 SASI_Rn01_00064823 predicted 833
12 SASI_Rn01_00064827 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141729 predicted 705
2 SASI_Mm01_00141730 predicted 473
3 SASI_Mm01_00141731 predicted 784
4 SASI_Mm01_00141733 predicted 652
5 SASI_Mm01_00141734 predicted 750
6 SASI_Mm01_00141735 predicted 717
7 SASI_Mm01_00141736 predicted 697
8 SASI_Mm02_00325638 predicted 478
9 SASI_Mm01_00141737 predicted 650
10 SASI_Mm01_00141738 predicted 754
11 SASI_Mm01_00141732 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005472
KCNE3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Isk-related family, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-347s1c1
Sequence:CCGGCCGTGATGACAACTCCTACATCTCGAGATGTAGGAGTTGTCATCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005472.4-887s21c1
Sequence:CCGGAGCCCATGAACAAACATATAACTCGAGTTATATGTTTGTTCATGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005472.4-539s21c1
Sequence:CCGGCATGTTTCTATTTGCTGTAACCTCGAGGTTACAGCAAATAGAAACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-482s1c1
Sequence:CCGGGAACCGTGTGTCTATGATCTACTCGAGTAGATCATAGACACACGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-359s1c1
Sequence:CCGGCTCCTACATGTACATTCTCTTCTCGAGAAGAGAATGTACATGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-436s1c1
Sequence:CCGGCCCGCAAAGTGGACAAGCGTACTCGAGTACGCTTGTCCACTTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-237s1c1
Sequence:CCGGGCCGTGCTGAAGGCTCTAAATCTCGAGATTTAGAGCCTTCAGCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005472.4-416s21c1
Sequence:CCGGCACTCTTCACAGCAATTTGCTCTCGAGAGCAAATTGCTGTGAAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005472
KCNE3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Isk-related family, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-347s1c1
Sequence:CCGGCCGTGATGACAACTCCTACATCTCGAGATGTAGGAGTTGTCATCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005472.4-887s21c1
Sequence:CCGGAGCCCATGAACAAACATATAACTCGAGTTATATGTTTGTTCATGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005472.4-539s21c1
Sequence:CCGGCATGTTTCTATTTGCTGTAACCTCGAGGTTACAGCAAATAGAAACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-482s1c1
Sequence:CCGGGAACCGTGTGTCTATGATCTACTCGAGTAGATCATAGACACACGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-359s1c1
Sequence:CCGGCTCCTACATGTACATTCTCTTCTCGAGAAGAGAATGTACATGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-436s1c1
Sequence:CCGGCCCGCAAAGTGGACAAGCGTACTCGAGTACGCTTGTCCACTTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-237s1c1
Sequence:CCGGGCCGTGCTGAAGGCTCTAAATCTCGAGATTTAGAGCCTTCAGCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005472.4-416s21c1
Sequence:CCGGCACTCTTCACAGCAATTTGCTCTCGAGAGCAAATTGCTGTGAAGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005472
KCNE3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Isk-related family, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-347s1c1
Sequence:CCGGCCGTGATGACAACTCCTACATCTCGAGATGTAGGAGTTGTCATCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005472.4-887s21c1
Sequence:CCGGAGCCCATGAACAAACATATAACTCGAGTTATATGTTTGTTCATGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005472.4-539s21c1
Sequence:CCGGCATGTTTCTATTTGCTGTAACCTCGAGGTTACAGCAAATAGAAACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-482s1c1
Sequence:CCGGGAACCGTGTGTCTATGATCTACTCGAGTAGATCATAGACACACGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-359s1c1
Sequence:CCGGCTCCTACATGTACATTCTCTTCTCGAGAAGAGAATGTACATGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-436s1c1
Sequence:CCGGCCCGCAAAGTGGACAAGCGTACTCGAGTACGCTTGTCCACTTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005472.2-237s1c1
Sequence:CCGGGCCGTGCTGAAGGCTCTAAATCTCGAGATTTAGAGCCTTCAGCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005472.4-416s21c1
Sequence:CCGGCACTCTTCACAGCAATTTGCTCTCGAGAGCAAATTGCTGTGAAGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020574
KCNE3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Isk-related family, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-613s1c1
Sequence:CCGGCATCAAGAACCGTGTGTCTATCTCGAGATAGACACACGGTTCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-443s1c1
Sequence:CCGGCCAGACAATCAAACTGAGGATCTCGAGATCCTCAGTTTGATTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-546s1c1
Sequence:CCGGGCAGTCTCATCCTGGGATATACTCGAGTATATCCCAGGATGAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-569s1c1
Sequence:CCGGCGTTCACGCAAAGTGGACAAACTCGAGTTTGTCCACTTTGCGTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-394s1c1
Sequence:CCGGCACAACCCTTCACAGTCACTTCTCGAGAAGTGACTGTGAAGGGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020574
KCNE3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Isk-related family, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-613s1c1
Sequence:CCGGCATCAAGAACCGTGTGTCTATCTCGAGATAGACACACGGTTCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-443s1c1
Sequence:CCGGCCAGACAATCAAACTGAGGATCTCGAGATCCTCAGTTTGATTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-546s1c1
Sequence:CCGGGCAGTCTCATCCTGGGATATACTCGAGTATATCCCAGGATGAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-569s1c1
Sequence:CCGGCGTTCACGCAAAGTGGACAAACTCGAGTTTGTCCACTTTGCGTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-394s1c1
Sequence:CCGGCACAACCCTTCACAGTCACTTCTCGAGAAGTGACTGTGAAGGGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020574
KCNE3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Isk-related family, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-613s1c1
Sequence:CCGGCATCAAGAACCGTGTGTCTATCTCGAGATAGACACACGGTTCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-443s1c1
Sequence:CCGGCCAGACAATCAAACTGAGGATCTCGAGATCCTCAGTTTGATTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-546s1c1
Sequence:CCGGGCAGTCTCATCCTGGGATATACTCGAGTATATCCCAGGATGAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-569s1c1
Sequence:CCGGCGTTCACGCAAAGTGGACAAACTCGAGTTTGTCCACTTTGCGTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020574.3-394s1c1
Sequence:CCGGCACAACCCTTCACAGTCACTTCTCGAGAAGTGACTGTGAAGGGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)