EMAIL THIS PAGE TO A FRIEND

KCNE4

potassium voltage-gated channel, Isk-related family, member 4

86 Gene Product Result for
Synonyms: MIRP3
UniProtKB ID: Q8WWG9, Q53SM4, Q96CC4
Gene ID:
Human(23704) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a type I membrane protein, and a beta subunit that assembles with a potassium channel alpha-subunit to modulate the gating kinetics and enhance stability of the multimeric complex. This gene is prominently expressed in the embryo and in adult uterus. [provided by RefSeq, Jul 2008]
Mouse(57814) potassium voltage-gated channel, Isk-related subfamily, gene 4
Rat(367302) potassium voltage-gated channel, Isk-related family, member 4
Zebrafish(794240) potassium voltage-gated channel, Isk-related family, member 4
cow(615761) potassium voltage-gated channel, Isk-related family, member 4
chicken(771271) potassium voltage-gated channel, Isk-related family, member 4
dog(488549) potassium voltage-gated channel, Isk-related family, member 4
domestic cat(101083535) potassium voltage-gated channel, Isk-related family, member 4
sheep(101120989) potassium voltage-gated channel, Isk-related family, member 4
Domestic Rabbit(100037711) potassium voltage-gated channel, Isk-related family, member 4
domestic guinea pig(100730426) potassium voltage-gated channel, Isk-related family, member 4
naked mole-rat(101700741) potassium voltage-gated channel, Isk-related family, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080671 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016381 MISSION® esiRNA esiRNA targeting human KCNE4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080671 Rosetta Predictions human pricing
NM_212526 Rosetta Predictions rat pricing
NM_021342 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362437 predicted 939
2 SASI_Hs01_00053239 predicted 883
3 SASI_Hs01_00053240 predicted 268
4 SASI_Hs01_00053241 predicted 860
5 SASI_Hs02_00362438 predicted 255
6 SASI_Hs01_00053242 predicted 889
7 SASI_Hs01_00053243 predicted 857
8 SASI_Hs02_00362439 predicted 631
9 SASI_Hs01_00053247 predicted 946
10 SASI_Hs01_00053245 predicted 687
11 SASI_Hs01_00053238 predicted 889
12 SASI_Hs01_00053244 predicted 240
13 SASI_Hs01_00053246 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062460 predicted 318
2 SASI_Rn01_00062461 predicted 271
3 SASI_Rn01_00062463 predicted 368
4 SASI_Rn01_00062464 predicted 272
5 SASI_Rn01_00062465 predicted 321
6 SASI_Rn01_00062466 predicted 377
7 SASI_Rn02_00270550 predicted 282
8 SASI_Rn01_00062468 predicted 400
9 SASI_Rn02_00270551 predicted 276
10 SASI_Rn01_00062469 predicted 351
11 SASI_Rn01_00062462 predicted 362
12 SASI_Rn01_00062467 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172449 predicted 788
2 SASI_Mm01_00172450 predicted 946
3 SASI_Mm02_00325922 predicted 272
4 SASI_Mm01_00172451 predicted 632
5 SASI_Mm01_00172452 predicted 366
6 SASI_Mm01_00172453 predicted 971
7 SASI_Mm01_00172454 predicted 752
8 SASI_Mm01_00172455 predicted 1075
9 SASI_Mm01_00172456 predicted 883
10 SASI_Mm01_00172457 predicted 1029
11 SASI_Mm01_00172458 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080671
VALIDATED
KCNE4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Isk-related family, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080671.2-358s21c1
Sequence:CCGGCCTCCTGCTGCTGTACAAAGACTCGAGTCTTTGTACAGCAGCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080671.2-1089s21c1
Sequence:CCGGTTGTCCTTCTAGATCTGATTGCTCGAGCAATCAGATCTAGAAGGACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080671.2-552s21c1
Sequence:CCGGACGTGCACCTCACCATTCAGGCTCGAGCCTGAATGGTGAGGTGCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080671.1-251s1c1
Sequence:CCGGGCTGGGCTACATGAAATCCAACTCGAGTTGGATTTCATGTAGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080671.1-263s1c1
Sequence:CCGGGAAATCCAAGAGGCGGGAGAACTCGAGTTCTCCCGCCTCTTGGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080671.1-575s1c1
Sequence:CCGGCTCGGAGAACATCCATCAGAACTCGAGTTCTGATGGATGTTCTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080671.1-176s1c1
Sequence:CCGGCAGCGGCAATGGCAACGAGTACTCGAGTACTCGTTGCCATTGCCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080671.1-197s1c1
Sequence:CCGGCTTCTACATTCTGGTTGTCATCTCGAGATGACAACCAGAATGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080671
VALIDATED
KCNE4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Isk-related family, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080671.2-358s21c1
Sequence:CCGGCCTCCTGCTGCTGTACAAAGACTCGAGTCTTTGTACAGCAGCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080671.2-1089s21c1
Sequence:CCGGTTGTCCTTCTAGATCTGATTGCTCGAGCAATCAGATCTAGAAGGACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080671.2-552s21c1
Sequence:CCGGACGTGCACCTCACCATTCAGGCTCGAGCCTGAATGGTGAGGTGCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080671.1-251s1c1
Sequence:CCGGGCTGGGCTACATGAAATCCAACTCGAGTTGGATTTCATGTAGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080671.1-263s1c1
Sequence:CCGGGAAATCCAAGAGGCGGGAGAACTCGAGTTCTCCCGCCTCTTGGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080671.1-575s1c1
Sequence:CCGGCTCGGAGAACATCCATCAGAACTCGAGTTCTGATGGATGTTCTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080671.1-176s1c1
Sequence:CCGGCAGCGGCAATGGCAACGAGTACTCGAGTACTCGTTGCCATTGCCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080671.1-197s1c1
Sequence:CCGGCTTCTACATTCTGGTTGTCATCTCGAGATGACAACCAGAATGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080671
VALIDATED
KCNE4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Isk-related family, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080671.2-358s21c1
Sequence:CCGGCCTCCTGCTGCTGTACAAAGACTCGAGTCTTTGTACAGCAGCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080671.2-1089s21c1
Sequence:CCGGTTGTCCTTCTAGATCTGATTGCTCGAGCAATCAGATCTAGAAGGACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080671.2-552s21c1
Sequence:CCGGACGTGCACCTCACCATTCAGGCTCGAGCCTGAATGGTGAGGTGCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080671.1-251s1c1
Sequence:CCGGGCTGGGCTACATGAAATCCAACTCGAGTTGGATTTCATGTAGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080671.1-263s1c1
Sequence:CCGGGAAATCCAAGAGGCGGGAGAACTCGAGTTCTCCCGCCTCTTGGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080671.1-575s1c1
Sequence:CCGGCTCGGAGAACATCCATCAGAACTCGAGTTCTGATGGATGTTCTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080671.1-176s1c1
Sequence:CCGGCAGCGGCAATGGCAACGAGTACTCGAGTACTCGTTGCCATTGCCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080671.1-197s1c1
Sequence:CCGGCTTCTACATTCTGGTTGTCATCTCGAGATGACAACCAGAATGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021342
KCNE4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Isk-related family, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-562s1c1
Sequence:CCGGCCGAGAACATCCACCAGAATTCTCGAGAATTCTGGTGGATGTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-332s1c1
Sequence:CCGGGCTACCTATGATGTCCGGCTTCTCGAGAAGCCGGACATCATAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021342.1-2337s1c1
Sequence:CCGGCGCCTGTTACAAAGTGATGTACTCGAGTACATCACTTTGTAACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-160s1c1
Sequence:CCGGGCAGTGGTAATGGCAATGAATCTCGAGATTCATTGCCATTACCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-149s1c1
Sequence:CCGGGCCTAGTAACAGCAGTGGTAACTCGAGTTACCACTGCTGTTACTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021342
KCNE4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Isk-related family, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-562s1c1
Sequence:CCGGCCGAGAACATCCACCAGAATTCTCGAGAATTCTGGTGGATGTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-332s1c1
Sequence:CCGGGCTACCTATGATGTCCGGCTTCTCGAGAAGCCGGACATCATAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021342.1-2337s1c1
Sequence:CCGGCGCCTGTTACAAAGTGATGTACTCGAGTACATCACTTTGTAACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-160s1c1
Sequence:CCGGGCAGTGGTAATGGCAATGAATCTCGAGATTCATTGCCATTACCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-149s1c1
Sequence:CCGGGCCTAGTAACAGCAGTGGTAACTCGAGTTACCACTGCTGTTACTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021342
KCNE4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Isk-related family, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-562s1c1
Sequence:CCGGCCGAGAACATCCACCAGAATTCTCGAGAATTCTGGTGGATGTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-332s1c1
Sequence:CCGGGCTACCTATGATGTCCGGCTTCTCGAGAAGCCGGACATCATAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021342.1-2337s1c1
Sequence:CCGGCGCCTGTTACAAAGTGATGTACTCGAGTACATCACTTTGTAACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-160s1c1
Sequence:CCGGGCAGTGGTAATGGCAATGAATCTCGAGATTCATTGCCATTACCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021342.1-149s1c1
Sequence:CCGGGCCTAGTAACAGCAGTGGTAACTCGAGTTACCACTGCTGTTACTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)