EMAIL THIS PAGE TO A FRIEND

KCNF1

potassium voltage-gated channel, subfamily F, member 1

63 Gene Product Result for
Synonyms: IK8 KCNF KV5.1 kH1
UniProtKB ID: Q9H3M0, O43527, Q585L3
Gene ID:
Human(3754) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily F. This gene is intronless and expressed in all tissues tested, including the heart, skeletal muscle, brain, kidney, and pancreas. [provided by RefSeq, Jul 2008]
Mouse(382571) potassium voltage-gated channel, subfamily F, member 1
Rat(298908) potassium voltage-gated channel, subfamily F, member 1
domestic guinea pig(100714352) potassium voltage-gated channel, subfamily F, member 1
naked mole-rat(101725666) potassium voltage-gated channel, subfamily F, member 1
sheep(101103556) potassium voltage-gated channel, subfamily F, member 1
chicken(428652) potassium voltage-gated channel, subfamily F, member 1
domestic cat(101095006) potassium voltage-gated channel, subfamily F, member 1
cow(505879) potassium voltage-gated channel, subfamily F, member 1
Horse(100056963) potassium voltage-gated channel, subfamily F, member 1
dog(482968) potassium voltage-gated channel, subfamily F, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002236 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020401 MISSION® esiRNA esiRNA human KCNF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002236 Rosetta Predictions human pricing
XM_001074279 Rosetta Predictions rat pricing
XM_216678 Rosetta Predictions rat pricing
NM_201531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033169 predicted 754
2 SASI_Hs01_00033170 predicted 1428
3 SASI_Hs01_00033171 predicted 1225
4 SASI_Hs01_00033172 predicted 1534
5 SASI_Hs02_00333471 predicted 743
6 SASI_Hs01_00033173 predicted 2015
7 SASI_Hs01_00033175 predicted 1072
8 SASI_Hs01_00033176 predicted 1768
9 SASI_Hs01_00033177 predicted 1317
10 SASI_Hs02_00333472 predicted 2016
11 SASI_Hs01_00033174 predicted 853
12 SASI_Hs01_00033178 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345683 predicted 780
2 SASI_Rn02_00345684 predicted 595
3 SASI_Rn02_00345685 predicted 1480
4 SASI_Rn02_00345686 predicted 2066
5 SASI_Rn02_00345687 predicted 782
6 SASI_Rn02_00345688 predicted 799
7 SASI_Rn02_00345689 predicted 791
8 SASI_Rn02_00345690 predicted 1137
9 SASI_Rn02_00345691 predicted 2096
10 SASI_Rn02_00345692 predicted 2070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376710 predicted 782
2 SASI_Rn02_00376711 predicted 592
3 SASI_Rn02_00376712 predicted 1481
4 SASI_Rn02_00376713 predicted 2067
5 SASI_Rn02_00376714 predicted 785
6 SASI_Rn02_00376715 predicted 797
7 SASI_Rn02_00376716 predicted 789
8 SASI_Rn02_00376717 predicted 1138
9 SASI_Rn02_00376718 predicted 2095
10 SASI_Rn02_00376719 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162787 predicted 406
2 SASI_Mm01_00162788 predicted 2145
3 SASI_Mm01_00162789 predicted 604
4 SASI_Mm01_00162791 predicted 1795
5 SASI_Mm01_00162792 predicted 2038
6 SASI_Mm01_00162793 predicted 598
7 SASI_Mm01_00162794 predicted 589
8 SASI_Mm01_00162795 predicted 1162
9 SASI_Mm01_00162796 predicted 1388
10 SASI_Mm02_00351605 predicted 405
11 SASI_Mm01_00162790 predicted 1882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002236
KCNF1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily F, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-553s1c1
Sequence:CCGGCGACATAGAGATAGTCGTCAACTCGAGTTGACGACTATCTCTATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-1210s1c1
Sequence:CCGGCCTCTTCTCGTCACCCAACAACTCGAGTTGTTGGGTGACGAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-715s1c1
Sequence:CCGGCGAGTTCTACTTTGACAGGGACTCGAGTCCCTGTCAAAGTAGAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-748s1c1
Sequence:CCGGCAAGTGTGTCATCGAGGTGTACTCGAGTACACCTCGATGACACACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-1711s1c1
Sequence:CCGGCAACTTTGTCAGGTACTACAACTCGAGTTGTAGTACCTGACAAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002236.4-834s21c1
Sequence:CCGGTCTGGAAGGTGGACCTCAAGTCTCGAGACTTGAGGTCCACCTTCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002236.4-1533s21c1
Sequence:CCGGGCCATCCAGAGACCCTGTTTACTCGAGTAAACAGGGTCTCTGGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002236.4-2024s21c1
Sequence:CCGGAGATGTGGCAGGCATGTCATCCTCGAGGATGACATGCCTGCCACATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002236
KCNF1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily F, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-553s1c1
Sequence:CCGGCGACATAGAGATAGTCGTCAACTCGAGTTGACGACTATCTCTATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-1210s1c1
Sequence:CCGGCCTCTTCTCGTCACCCAACAACTCGAGTTGTTGGGTGACGAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-715s1c1
Sequence:CCGGCGAGTTCTACTTTGACAGGGACTCGAGTCCCTGTCAAAGTAGAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-748s1c1
Sequence:CCGGCAAGTGTGTCATCGAGGTGTACTCGAGTACACCTCGATGACACACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-1711s1c1
Sequence:CCGGCAACTTTGTCAGGTACTACAACTCGAGTTGTAGTACCTGACAAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002236.4-834s21c1
Sequence:CCGGTCTGGAAGGTGGACCTCAAGTCTCGAGACTTGAGGTCCACCTTCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002236.4-1533s21c1
Sequence:CCGGGCCATCCAGAGACCCTGTTTACTCGAGTAAACAGGGTCTCTGGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002236.4-2024s21c1
Sequence:CCGGAGATGTGGCAGGCATGTCATCCTCGAGGATGACATGCCTGCCACATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002236
KCNF1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily F, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-553s1c1
Sequence:CCGGCGACATAGAGATAGTCGTCAACTCGAGTTGACGACTATCTCTATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-1210s1c1
Sequence:CCGGCCTCTTCTCGTCACCCAACAACTCGAGTTGTTGGGTGACGAGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-715s1c1
Sequence:CCGGCGAGTTCTACTTTGACAGGGACTCGAGTCCCTGTCAAAGTAGAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-748s1c1
Sequence:CCGGCAAGTGTGTCATCGAGGTGTACTCGAGTACACCTCGATGACACACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002236.4-1711s1c1
Sequence:CCGGCAACTTTGTCAGGTACTACAACTCGAGTTGTAGTACCTGACAAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002236.4-834s21c1
Sequence:CCGGTCTGGAAGGTGGACCTCAAGTCTCGAGACTTGAGGTCCACCTTCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002236.4-1533s21c1
Sequence:CCGGGCCATCCAGAGACCCTGTTTACTCGAGTAAACAGGGTCTCTGGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002236.4-2024s21c1
Sequence:CCGGAGATGTGGCAGGCATGTCATCCTCGAGGATGACATGCCTGCCACATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201531
KCNF1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily F, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-1387s1c1
Sequence:CCGGCCATCCTGAAACTCTGTTCAACTCGAGTTGAACAGAGTTTCAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-407s1c1
Sequence:CCGGGACATTGAGATCGTGGTAAATCTCGAGATTTACCACGATCTCAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-532s1c1
Sequence:CCGGCTTCTCTCTGTGCGACGATTACTCGAGTAATCGTCGCACAGAGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-1033s1c1
Sequence:CCGGCGGCTGGTTCACTCTGGAGTACTCGAGTACTCCAGAGTGAACCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-1571s1c1
Sequence:CCGGGTCAGGTACTACAACAAACAACTCGAGTTGTTTGTTGTAGTACCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201531
KCNF1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily F, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-1387s1c1
Sequence:CCGGCCATCCTGAAACTCTGTTCAACTCGAGTTGAACAGAGTTTCAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-407s1c1
Sequence:CCGGGACATTGAGATCGTGGTAAATCTCGAGATTTACCACGATCTCAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-532s1c1
Sequence:CCGGCTTCTCTCTGTGCGACGATTACTCGAGTAATCGTCGCACAGAGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-1033s1c1
Sequence:CCGGCGGCTGGTTCACTCTGGAGTACTCGAGTACTCCAGAGTGAACCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-1571s1c1
Sequence:CCGGGTCAGGTACTACAACAAACAACTCGAGTTGTTTGTTGTAGTACCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201531
KCNF1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily F, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-1387s1c1
Sequence:CCGGCCATCCTGAAACTCTGTTCAACTCGAGTTGAACAGAGTTTCAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-407s1c1
Sequence:CCGGGACATTGAGATCGTGGTAAATCTCGAGATTTACCACGATCTCAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-532s1c1
Sequence:CCGGCTTCTCTCTGTGCGACGATTACTCGAGTAATCGTCGCACAGAGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-1033s1c1
Sequence:CCGGCGGCTGGTTCACTCTGGAGTACTCGAGTACTCCAGAGTGAACCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201531.1-1571s1c1
Sequence:CCGGGTCAGGTACTACAACAAACAACTCGAGTTGTTTGTTGTAGTACCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)