EMAIL THIS PAGE TO A FRIEND

KCNG2

potassium voltage-gated channel, subfamily G, member 2

62 Gene Product Result for
Synonyms: KCNF2 KV6.2
UniProtKB ID: Q9UJ96
Gene ID:
Human(26251) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member is a gamma subunit of the voltage-gated potassium channel. The delayed-rectifier type channels containing this subunit may contribute to cardiac action potential repolarization. [provided by RefSeq, Jul 2008]
Mouse(240444) potassium voltage-gated channel, subfamily G, member 2
Rat(307234) potassium voltage-gated channel, subfamily G, member 2
domestic guinea pig(100734214) potassium voltage-gated channel, subfamily G, member 2
sheep(101107566) potassium voltage-gated channel, subfamily G, member 2
chicken(395902) potassium voltage-gated channel, subfamily G, member 2
cow(506324) potassium voltage-gated channel, subfamily G, member 2
dog(607004) potassium voltage-gated channel, subfamily G, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_140499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_140499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_140499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012283 Rosetta Predictions human pricing
NM_001107372 Rosetta Predictions rat pricing
XM_225718 Rosetta Predictions rat pricing
XM_140499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103704 predicted 1086
2 SASI_Hs01_00103706 predicted 875
3 SASI_Hs01_00103709 predicted 866
4 SASI_Hs02_00344019 predicted 868
5 SASI_Hs01_00103710 predicted 992
6 SASI_Hs01_00103712 predicted 776
7 SASI_Hs01_00103713 predicted 733
8 SASI_Hs02_00344020 predicted 939
9 SASI_Hs02_00344021 predicted 1114
10 SASI_Hs02_00344022 predicted 744
11 SASI_Hs01_00103705 predicted 745
12 SASI_Hs01_00103707 predicted 1175
13 SASI_Hs01_00103708 predicted 1081
14 SASI_Hs01_00103711 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228175 predicted 938
2 SASI_Rn02_00228176 predicted 843
3 SASI_Rn02_00228177 predicted 387
4 SASI_Rn02_00228178 predicted 1410
5 SASI_Rn02_00228179 predicted 830
6 SASI_Rn02_00228180 predicted 932
7 SASI_Rn02_00228181 predicted 1420
8 SASI_Rn02_00228182 predicted 1168
9 SASI_Rn02_00228183 predicted 941
10 SASI_Rn02_00228184 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160991 predicted 571
2 SASI_Rn01_00160992 predicted 437
3 SASI_Rn01_00160993 predicted 657
4 SASI_Rn01_00160994 predicted 978
5 SASI_Rn01_00160995 predicted 557
6 SASI_Rn01_00160996 predicted 226
7 SASI_Rn01_00160997 predicted 548
8 SASI_Rn01_00160998 predicted 647
9 SASI_Rn01_00160999 predicted 556
10 SASI_Rn01_00161000 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424962 predicted 1781
2 SASI_Mm01_00213302 predicted 1750
3 SASI_Mm02_00424963 predicted 1709
4 SASI_Mm01_00213307 predicted 1889
5 SASI_Mm02_00424964 predicted 1843
6 SASI_Mm02_00424965 predicted 220
7 SASI_Mm01_00213298 predicted 1249
8 SASI_Mm01_00213299 predicted 685
9 SASI_Mm01_00213300 predicted 1513
10 SASI_Mm01_00213301 predicted 1513
11 SASI_Mm01_00213303 predicted 1575
12 SASI_Mm01_00213304 predicted 1442
13 SASI_Mm01_00213305 predicted 1511
14 SASI_Mm01_00213306 predicted 1592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012283
KCNG2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily G, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-747s1c1
Sequence:CCGGGCCACTCAACATCATTGACATCTCGAGATGTCAATGATGTTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-1227s1c1
Sequence:CCGGGCGCTCCTACTCCGAGCTCAACTCGAGTTGAGCTCGGAGTAGGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-1074s1c1
Sequence:CCGGCAGCTATTGGTGGGCCGTCATCTCGAGATGACGGCCCACCAATAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-585s1c1
Sequence:CCGGCCTGAGCACCATGCCGGACATCTCGAGATGTCCGGCATGGTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-653s21c1
Sequence:CCGGTGTTCGTGCTGGAGACCGTGTCTCGAGACACGGTCTCCAGCACGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-48s21c1
Sequence:CCGGCCGGCACGTCATCATCAACGTCTCGAGACGTTGATGATGACGTGCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-173s21c1
Sequence:CCGGTGTGTGACGACTACGACGTGACTCGAGTCACGTCGTAGTCGTCACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-681s21c1
Sequence:CCGGCTGGTTCTCCTTCGAGTTCCTCTCGAGAGGAACTCGAAGGAGAACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012283
KCNG2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily G, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-747s1c1
Sequence:CCGGGCCACTCAACATCATTGACATCTCGAGATGTCAATGATGTTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-1227s1c1
Sequence:CCGGGCGCTCCTACTCCGAGCTCAACTCGAGTTGAGCTCGGAGTAGGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-1074s1c1
Sequence:CCGGCAGCTATTGGTGGGCCGTCATCTCGAGATGACGGCCCACCAATAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-585s1c1
Sequence:CCGGCCTGAGCACCATGCCGGACATCTCGAGATGTCCGGCATGGTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-653s21c1
Sequence:CCGGTGTTCGTGCTGGAGACCGTGTCTCGAGACACGGTCTCCAGCACGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-48s21c1
Sequence:CCGGCCGGCACGTCATCATCAACGTCTCGAGACGTTGATGATGACGTGCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-173s21c1
Sequence:CCGGTGTGTGACGACTACGACGTGACTCGAGTCACGTCGTAGTCGTCACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-681s21c1
Sequence:CCGGCTGGTTCTCCTTCGAGTTCCTCTCGAGAGGAACTCGAAGGAGAACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012283
KCNG2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily G, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-747s1c1
Sequence:CCGGGCCACTCAACATCATTGACATCTCGAGATGTCAATGATGTTGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-1227s1c1
Sequence:CCGGGCGCTCCTACTCCGAGCTCAACTCGAGTTGAGCTCGGAGTAGGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-1074s1c1
Sequence:CCGGCAGCTATTGGTGGGCCGTCATCTCGAGATGACGGCCCACCAATAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012283.1-585s1c1
Sequence:CCGGCCTGAGCACCATGCCGGACATCTCGAGATGTCCGGCATGGTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-653s21c1
Sequence:CCGGTGTTCGTGCTGGAGACCGTGTCTCGAGACACGGTCTCCAGCACGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-48s21c1
Sequence:CCGGCCGGCACGTCATCATCAACGTCTCGAGACGTTGATGATGACGTGCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-173s21c1
Sequence:CCGGTGTGTGACGACTACGACGTGACTCGAGTCACGTCGTAGTCGTCACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012283.1-681s21c1
Sequence:CCGGCTGGTTCTCCTTCGAGTTCCTCTCGAGAGGAACTCGAAGGAGAACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_140499
KCNG2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily G, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-612s1c1
Sequence:CCGGGCGCTCCTATTCGGAGCTCAACTCGAGTTGAGCTCCGAATAGGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-132s1c1
Sequence:CCGGGCCGCTTGCCATCATCGACATCTCGAGATGTCGATGATGGCAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-30s1c1
Sequence:CCGGCCGCAACCTGTTCGTGCTGGACTCGAGTCCAGCACGAACAGGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-600s1c1
Sequence:CCGGCCACACCTTCTCGCGCTCCTACTCGAGTAGGAGCGCGAGAAGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-162s1c1
Sequence:CCGGCCTGCCCTTCTACGTGTCGCTCTCGAGAGCGACACGTAGAAGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_140499
KCNG2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily G, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-612s1c1
Sequence:CCGGGCGCTCCTATTCGGAGCTCAACTCGAGTTGAGCTCCGAATAGGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-132s1c1
Sequence:CCGGGCCGCTTGCCATCATCGACATCTCGAGATGTCGATGATGGCAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-30s1c1
Sequence:CCGGCCGCAACCTGTTCGTGCTGGACTCGAGTCCAGCACGAACAGGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-600s1c1
Sequence:CCGGCCACACCTTCTCGCGCTCCTACTCGAGTAGGAGCGCGAGAAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-162s1c1
Sequence:CCGGCCTGCCCTTCTACGTGTCGCTCTCGAGAGCGACACGTAGAAGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_140499
KCNG2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily G, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-612s1c1
Sequence:CCGGGCGCTCCTATTCGGAGCTCAACTCGAGTTGAGCTCCGAATAGGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-132s1c1
Sequence:CCGGGCCGCTTGCCATCATCGACATCTCGAGATGTCGATGATGGCAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-30s1c1
Sequence:CCGGCCGCAACCTGTTCGTGCTGGACTCGAGTCCAGCACGAACAGGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-600s1c1
Sequence:CCGGCCACACCTTCTCGCGCTCCTACTCGAGTAGGAGCGCGAGAAGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140499.3-162s1c1
Sequence:CCGGCCTGCCCTTCTACGTGTCGCTCTCGAGAGCGACACGTAGAAGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)