EMAIL THIS PAGE TO A FRIEND

KCNG4

potassium voltage-gated channel, subfamily G, member 4

67 Gene Product Result for
Synonyms: KV6.3 KV6.4
UniProtKB ID: Q8TDN1, Q96H24
Gene ID:
Human(93107) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member functions as a modulatory subunit. The gene has strong expression in brain. Multiple alternatively spliced variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]
Mouse(66733) potassium voltage-gated channel, subfamily G, member 4
Rat(307900) potassium voltage-gated channel, subfamily G, member 4
domestic guinea pig(100727348) potassium voltage-gated channel, subfamily G, member 4
naked mole-rat(101711011) potassium voltage-gated channel, subfamily G, member 4
sheep(101102663) potassium voltage-gated channel, subfamily G, member 4
Domestic Rabbit(100344541) potassium voltage-gated channel, subfamily G, member 4
Zebrafish(561003) potassium voltage-gated channel, subfamily G, member 4
chicken(395901) potassium voltage-gated channel, subfamily G, member 4
domestic cat(101082112) potassium voltage-gated channel, subfamily G, member 4
Horse(100056010) potassium voltage-gated channel, subfamily G, member 4
cow(534070) potassium voltage-gated channel, subfamily G, member 4
dog(489683) potassium voltage-gated channel, subfamily G, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133490 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133490 Rosetta Predictions human pricing
NM_172347 Rosetta Predictions human pricing
NM_001107435 Rosetta Predictions rat pricing
NM_025734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154964 predicted 441
2 SASI_Hs01_00154965 predicted 223
3 SASI_Hs01_00154966 predicted 228
4 SASI_Hs01_00154967 predicted 420
5 SASI_Hs01_00154968 predicted 394
6 SASI_Hs01_00154969 predicted 396
7 SASI_Hs01_00154970 predicted 219
8 SASI_Hs01_00154971 predicted 589
9 SASI_Hs01_00154972 predicted 1695
10 SASI_Hs01_00154973 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202795 predicted 883
2 SASI_Hs01_00202787 predicted 440
3 SASI_Hs01_00202788 predicted 212
4 SASI_Hs01_00202789 predicted 218
5 SASI_Hs02_00367989 predicted 941
6 SASI_Hs02_00367990 predicted 875
7 SASI_Hs02_00367991 predicted 1338
8 SASI_Hs02_00367992 predicted 1438
9 SASI_Hs02_00367993 predicted 936
10 SASI_Hs02_00367994 predicted 912
11 SASI_Hs01_00202790 predicted 422
12 SASI_Hs01_00202791 predicted 398
13 SASI_Hs01_00202792 predicted 395
14 SASI_Hs01_00202793 predicted 225
15 SASI_Hs01_00202794 predicted 595
16 SASI_Hs01_00202796 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107435 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228795 predicted 2278
2 SASI_Rn02_00228796 predicted 2135
3 SASI_Rn02_00228797 predicted 589
4 SASI_Rn02_00228798 predicted 2121
5 SASI_Rn02_00228799 predicted 2305
6 SASI_Rn02_00228800 predicted 1240
7 SASI_Rn02_00228801 predicted 1825
8 SASI_Rn02_00228802 predicted 753
9 SASI_Rn02_00228803 predicted 1704
10 SASI_Rn02_00228804 predicted 2114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128558 predicted 1087
2 SASI_Mm01_00128560 predicted 2014
3 SASI_Mm01_00128561 predicted 586
4 SASI_Mm01_00128562 predicted 1245
5 SASI_Mm01_00128563 predicted 2091
6 SASI_Mm01_00128564 predicted 1826
7 SASI_Mm01_00128565 predicted 651
8 SASI_Mm01_00128566 predicted 1703
9 SASI_Mm02_00328916 predicted 1242
10 SASI_Mm01_00128567 predicted 1586
11 SASI_Mm01_00128559 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133490
KCNG4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily G, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-412s1c1
Sequence:CCGGCGTGCAGCTCTGCGATGATTACTCGAGTAATCATCGCAGAGCTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-391s1c1
Sequence:CCGGCTGTCGGAGCTACGAGGAGATCTCGAGATCTCCTCGTAGCTCCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-283s1c1
Sequence:CCGGAGTGGACCTGAAGAAGGAGATCTCGAGATCTCCTTCTTCAGGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-778s1c1
Sequence:CCGGCGGGAAGGTCTTCGCTTGCCTCTCGAGAGGCAAGCGAAGACCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-220s1c1
Sequence:CCGGGCCGTCCATCAAGGGCCTTTACTCGAGTAAAGGCCCTTGATGGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133490
KCNG4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily G, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-412s1c1
Sequence:CCGGCGTGCAGCTCTGCGATGATTACTCGAGTAATCATCGCAGAGCTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-391s1c1
Sequence:CCGGCTGTCGGAGCTACGAGGAGATCTCGAGATCTCCTCGTAGCTCCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-283s1c1
Sequence:CCGGAGTGGACCTGAAGAAGGAGATCTCGAGATCTCCTTCTTCAGGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-778s1c1
Sequence:CCGGCGGGAAGGTCTTCGCTTGCCTCTCGAGAGGCAAGCGAAGACCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-220s1c1
Sequence:CCGGGCCGTCCATCAAGGGCCTTTACTCGAGTAAAGGCCCTTGATGGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133490
KCNG4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily G, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-412s1c1
Sequence:CCGGCGTGCAGCTCTGCGATGATTACTCGAGTAATCATCGCAGAGCTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-391s1c1
Sequence:CCGGCTGTCGGAGCTACGAGGAGATCTCGAGATCTCCTCGTAGCTCCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-283s1c1
Sequence:CCGGAGTGGACCTGAAGAAGGAGATCTCGAGATCTCCTTCTTCAGGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-778s1c1
Sequence:CCGGCGGGAAGGTCTTCGCTTGCCTCTCGAGAGGCAAGCGAAGACCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133490.2-220s1c1
Sequence:CCGGGCCGTCCATCAAGGGCCTTTACTCGAGTAAAGGCCCTTGATGGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025734
KCNG4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily G, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025734.2-3413s1c1
Sequence:CCGGCCCTGCTAACACATTGGTCTTCTCGAGAAGACCAATGTGTTAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-1949s1c1
Sequence:CCGGCTCCTGAGTGACGTAGATGATCTCGAGATCATCTACGTCACTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-653s1c1
Sequence:CCGGGCCAACTTGAAGGAGATCCTACTCGAGTAGGATCTCCTTCAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-1807s1c1
Sequence:CCGGCGGGATCCTTATCATGGCTTTCTCGAGAAAGCCATGATAAGGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-1336s1c1
Sequence:CCGGCCCGAACAAATGTCAGTTCTTCTCGAGAAGAACTGACATTTGTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025734
KCNG4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily G, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025734.2-3413s1c1
Sequence:CCGGCCCTGCTAACACATTGGTCTTCTCGAGAAGACCAATGTGTTAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-1949s1c1
Sequence:CCGGCTCCTGAGTGACGTAGATGATCTCGAGATCATCTACGTCACTCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-653s1c1
Sequence:CCGGGCCAACTTGAAGGAGATCCTACTCGAGTAGGATCTCCTTCAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-1807s1c1
Sequence:CCGGCGGGATCCTTATCATGGCTTTCTCGAGAAAGCCATGATAAGGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-1336s1c1
Sequence:CCGGCCCGAACAAATGTCAGTTCTTCTCGAGAAGAACTGACATTTGTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025734
KCNG4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily G, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025734.2-3413s1c1
Sequence:CCGGCCCTGCTAACACATTGGTCTTCTCGAGAAGACCAATGTGTTAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-1949s1c1
Sequence:CCGGCTCCTGAGTGACGTAGATGATCTCGAGATCATCTACGTCACTCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-653s1c1
Sequence:CCGGGCCAACTTGAAGGAGATCCTACTCGAGTAGGATCTCCTTCAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-1807s1c1
Sequence:CCGGCGGGATCCTTATCATGGCTTTCTCGAGAAAGCCATGATAAGGATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025734.2-1336s1c1
Sequence:CCGGCCCGAACAAATGTCAGTTCTTCTCGAGAAGAACTGACATTTGTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)