EMAIL THIS PAGE TO A FRIEND

KCNH1

potassium voltage-gated channel, subfamily H (eag-related), member 1

98 Gene Product Result for
Synonyms: EAG EAG1 Kv10.1 h-eag
UniProtKB ID: O95259, B1AQ26, O76035, Q14CL3
Gene ID:
Human(3756) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(16510) potassium voltage-gated channel, subfamily H (eag-related), member 1
Rat(65198) potassium voltage-gated channel, subfamily H (eag-related), member 1
chicken(421381) potassium voltage-gated channel, subfamily H (eag-related), member 1
dog(490277) potassium voltage-gated channel, subfamily H (eag-related), member 1
cow(281881) potassium voltage-gated channel, subfamily H (eag-related), member 1
Horse(100051219) potassium voltage-gated channel, subfamily H (eag-related), member 1
domestic cat(101093161) potassium voltage-gated channel, subfamily H (eag-related), member 1
sheep(101120348) potassium voltage-gated channel, subfamily H (eag-related), member 1
Domestic Rabbit(100340515) potassium voltage-gated channel, subfamily H (eag-related), member 1
domestic guinea pig(100719620) potassium voltage-gated channel, subfamily H (eag-related), member 1
naked mole-rat(101706330) potassium voltage-gated channel, subfamily H (eag-related), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002238 Rosetta Predictions human pricing
NM_172362 Rosetta Predictions human pricing
NM_031742 Rosetta Predictions rat pricing
NM_001038607 Rosetta Predictions mouse pricing
NM_010600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099372 predicted 1499
2 SASI_Hs01_00099373 predicted 859
3 SASI_Hs01_00099374 predicted 1674
4 SASI_Hs01_00099375 predicted 392
5 SASI_Hs01_00099376 predicted 1325
6 SASI_Hs01_00099377 predicted 1372
7 SASI_Hs01_00099378 predicted 1422
8 SASI_Hs01_00099379 predicted 1771
9 SASI_Hs01_00099380 predicted 1415
10 SASI_Hs02_00333480 predicted 1693
11 SASI_Hs01_00099371 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223874 predicted 1585
2 SASI_Hs01_00223875 predicted 863
3 SASI_Hs01_00223876 predicted 1753
4 SASI_Hs01_00223877 predicted 395
5 SASI_Hs01_00223878 predicted 1402
6 SASI_Hs01_00223879 predicted 1454
7 SASI_Hs01_00223880 predicted 1505
8 SASI_Hs01_00223881 predicted 1852
9 SASI_Hs01_00223882 predicted 1499
10 SASI_Hs02_00368013 predicted 1774
11 SASI_Hs01_00223873 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070153 predicted 344
2 SASI_Rn01_00070154 predicted 1454
3 SASI_Rn01_00070155 predicted 1467
4 SASI_Rn01_00070156 predicted 1450
5 SASI_Rn02_00265148 predicted 1074
6 SASI_Rn01_00070157 predicted 334
7 SASI_Rn01_00070158 predicted 909
8 SASI_Rn01_00070159 predicted 490
9 SASI_Rn01_00070160 predicted 832
10 SASI_Rn02_00265149 predicted 1542
11 SASI_Rn01_00070161 predicted 1820
12 SASI_Rn01_00070162 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169259 predicted 267
2 SASI_Mm01_00169260 predicted 1338
3 SASI_Mm01_00169261 predicted 840
4 SASI_Mm01_00169262 predicted 760
5 SASI_Mm01_00169263 predicted 1871
6 SASI_Mm01_00169264 predicted 1743
7 SASI_Mm01_00169265 predicted 418
8 SASI_Mm01_00169266 predicted 1335
9 SASI_Mm01_00169267 predicted 1391
10 SASI_Mm02_00289619 predicted 516
11 SASI_Mm01_00169268 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171239 predicted 266
2 SASI_Mm01_00171240 predicted 1421
3 SASI_Mm01_00171241 predicted 834
4 SASI_Mm01_00171242 predicted 761
5 SASI_Mm01_00171243 predicted 1957
6 SASI_Mm01_00171244 predicted 1824
7 SASI_Mm01_00171245 predicted 413
8 SASI_Mm01_00171246 predicted 1424
9 SASI_Mm01_00171247 predicted 1473
10 SASI_Mm02_00318917 predicted 515
11 SASI_Mm01_00171248 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010600
KCNH1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-2140s1c1
Sequence:CCGGCCCTTCAGAAAGTGCTAGAATCTCGAGATTCTAGCACTTTCTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-1391s1c1
Sequence:CCGGCGGCACTCCATACCAGTTTAACTCGAGTTAAACTGGTATGGAGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-731s1c1
Sequence:CCGGCCCTCACATCATCCTACACTACTCGAGTAGTGTAGGATGATGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-3048s1c1
Sequence:CCGGCCAGAGTCAGACAGAGACATTCTCGAGAATGTCTCTGTCTGACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-182s1c1
Sequence:CCGGGCGGTCCAACGACACTAATTTCTCGAGAAATTAGTGTCGTTGGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010600
KCNH1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-2140s1c1
Sequence:CCGGCCCTTCAGAAAGTGCTAGAATCTCGAGATTCTAGCACTTTCTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-1391s1c1
Sequence:CCGGCGGCACTCCATACCAGTTTAACTCGAGTTAAACTGGTATGGAGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-731s1c1
Sequence:CCGGCCCTCACATCATCCTACACTACTCGAGTAGTGTAGGATGATGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-3048s1c1
Sequence:CCGGCCAGAGTCAGACAGAGACATTCTCGAGAATGTCTCTGTCTGACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-182s1c1
Sequence:CCGGGCGGTCCAACGACACTAATTTCTCGAGAAATTAGTGTCGTTGGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010600
KCNH1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-2140s1c1
Sequence:CCGGCCCTTCAGAAAGTGCTAGAATCTCGAGATTCTAGCACTTTCTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-1391s1c1
Sequence:CCGGCGGCACTCCATACCAGTTTAACTCGAGTTAAACTGGTATGGAGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-731s1c1
Sequence:CCGGCCCTCACATCATCCTACACTACTCGAGTAGTGTAGGATGATGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-3048s1c1
Sequence:CCGGCCAGAGTCAGACAGAGACATTCTCGAGAATGTCTCTGTCTGACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010600.1-182s1c1
Sequence:CCGGGCGGTCCAACGACACTAATTTCTCGAGAAATTAGTGTCGTTGGACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002238
KCNH1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-420s1c1
Sequence:CCGGCGGCAAACATTTGAGAACTATCTCGAGATAGTTCTCAAATGTTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-237s1c1
Sequence:CCGGCGGCGGTCCAATGATACTAATCTCGAGATTAGTATCATTGGACCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-789s1c1
Sequence:CCGGCCTCACATCATCTTACATTATCTCGAGATAATGTAAGATGATGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-1190s1c1
Sequence:CCGGGCTGGACCACTACATTGAATACTCGAGTATTCAATGTAGTGGTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-2211s1c1
Sequence:CCGGCGGAAGATCAGCGATGTGAAACTCGAGTTTCACATCGCTGATCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002238.3-956s21c1
Sequence:CCGGGGTGGACATTGTGCTCAATTTCTCGAGAAATTGAGCACAATGTCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002238.3-1679s21c1
Sequence:CCGGAGGATTGAGTGAGCGAGTAATCTCGAGATTACTCGCTCACTCAATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002238.3-863s21c1
Sequence:CCGGAGCCATCTTGGTCCCTTATAACTCGAGTTATAAGGGACCAAGATGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002238
KCNH1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-420s1c1
Sequence:CCGGCGGCAAACATTTGAGAACTATCTCGAGATAGTTCTCAAATGTTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-237s1c1
Sequence:CCGGCGGCGGTCCAATGATACTAATCTCGAGATTAGTATCATTGGACCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-789s1c1
Sequence:CCGGCCTCACATCATCTTACATTATCTCGAGATAATGTAAGATGATGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-1190s1c1
Sequence:CCGGGCTGGACCACTACATTGAATACTCGAGTATTCAATGTAGTGGTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-2211s1c1
Sequence:CCGGCGGAAGATCAGCGATGTGAAACTCGAGTTTCACATCGCTGATCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002238.3-956s21c1
Sequence:CCGGGGTGGACATTGTGCTCAATTTCTCGAGAAATTGAGCACAATGTCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002238.3-1679s21c1
Sequence:CCGGAGGATTGAGTGAGCGAGTAATCTCGAGATTACTCGCTCACTCAATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002238.3-863s21c1
Sequence:CCGGAGCCATCTTGGTCCCTTATAACTCGAGTTATAAGGGACCAAGATGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002238
KCNH1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-420s1c1
Sequence:CCGGCGGCAAACATTTGAGAACTATCTCGAGATAGTTCTCAAATGTTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-237s1c1
Sequence:CCGGCGGCGGTCCAATGATACTAATCTCGAGATTAGTATCATTGGACCGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-789s1c1
Sequence:CCGGCCTCACATCATCTTACATTATCTCGAGATAATGTAAGATGATGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-1190s1c1
Sequence:CCGGGCTGGACCACTACATTGAATACTCGAGTATTCAATGTAGTGGTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002238.2-2211s1c1
Sequence:CCGGCGGAAGATCAGCGATGTGAAACTCGAGTTTCACATCGCTGATCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002238.3-956s21c1
Sequence:CCGGGGTGGACATTGTGCTCAATTTCTCGAGAAATTGAGCACAATGTCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002238.3-1679s21c1
Sequence:CCGGAGGATTGAGTGAGCGAGTAATCTCGAGATTACTCGCTCACTCAATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002238.3-863s21c1
Sequence:CCGGAGCCATCTTGGTCCCTTATAACTCGAGTTATAAGGGACCAAGATGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)