EMAIL THIS PAGE TO A FRIEND

KCNH3

potassium voltage-gated channel, subfamily H (eag-related), member 3

51 Gene Product Result for
Synonyms: BEC1 ELK2 Kv12.2
UniProtKB ID: Q9ULD8, Q9UQ06
Gene ID:
Mouse(16512) potassium voltage-gated channel, subfamily H (eag-related), member 3
Rat(27150) potassium voltage-gated channel, subfamily H (eag-related), member 3
Zebrafish(100884143) potassium voltage-gated channel, subfamily H (eag-related), member 3
dog(486556) potassium voltage-gated channel, subfamily H (eag-related), member 3
domestic cat(101083274) potassium voltage-gated channel, subfamily H (eag-related), member 3
cow(514409) potassium voltage-gated channel, subfamily H (eag-related), member 3
sheep(101118435) potassium voltage-gated channel, subfamily H (eag-related), member 3
domestic guinea pig(100725407) potassium voltage-gated channel, subfamily H (eag-related), member 3
naked mole-rat(101712694) potassium voltage-gated channel, subfamily H (eag-related), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012284 Rosetta Predictions human pricing
NM_017108 Rosetta Predictions rat pricing
NM_010601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344023 predicted 1168
2 SASI_Hs01_00119036 predicted 2784
3 SASI_Hs01_00119037 predicted 3445
4 SASI_Hs01_00119038 predicted 850
5 SASI_Hs01_00119039 predicted 554
6 SASI_Hs01_00119040 predicted 638
7 SASI_Hs01_00119041 predicted 1944
8 SASI_Hs02_00344024 predicted 545
9 SASI_Hs01_00119043 predicted 1822
10 SASI_Hs01_00119044 predicted 1960
11 SASI_Hs01_00119042 predicted 1523
12 SASI_Hs01_00119045 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118223 predicted 742
2 SASI_Rn01_00118224 predicted 419
3 SASI_Rn01_00118225 predicted 1799
4 SASI_Rn01_00118226 predicted 1515
5 SASI_Rn01_00118227 predicted 1679
6 SASI_Rn01_00118228 predicted 756
7 SASI_Rn01_00118229 predicted 1107
8 SASI_Rn01_00118230 predicted 433
9 SASI_Rn01_00118231 predicted 996
10 SASI_Rn01_00118232 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043134 predicted 273
2 SASI_Mm01_00043135 predicted 1544
3 SASI_Mm01_00043136 predicted 456
4 SASI_Mm01_00043137 predicted 1666
5 SASI_Mm01_00043138 predicted 276
6 SASI_Mm01_00043139 predicted 841
7 SASI_Mm01_00043140 predicted 1905
8 SASI_Mm01_00043141 predicted 569
9 SASI_Mm01_00043142 predicted 595
10 SASI_Mm01_00043143 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012284
KCNH3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012284.1-2414s21c1
Sequence:CCGGGAGCGGCGACAATACCCTTATCTCGAGATAAGGGTATTGTCGCCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-1091s1c1
Sequence:CCGGGCTGAATTTCCGTACCACATTCTCGAGAATGTGGTACGGAAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-1079s1c1
Sequence:CCGGCCTTGACATTGTGCTGAATTTCTCGAGAAATTCAGCACAATGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012284.1-3516s1c1
Sequence:CCGGCCAGCCCTAGAACTCAGCGTTCTCGAGAACGCTGAGTTCTAGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-3121s1c1
Sequence:CCGGGCTCTGTCTTGAGTGGGACTTCTCGAGAAGTCCCACTCAAGACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-588s1c1
Sequence:CCGGCTCCTGGATGTGATACCCATACTCGAGTATGGGTATCACATCCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012284.1-859s21c1
Sequence:CCGGCAAACTTGCCTGAGTACAAAGCTCGAGCTTTGTACTCAGGCAAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012284.1-733s21c1
Sequence:CCGGCACGATCCAAAGGCTTCAATGCTCGAGCATTGAAGCCTTTGGATCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012284
KCNH3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012284.1-2414s21c1
Sequence:CCGGGAGCGGCGACAATACCCTTATCTCGAGATAAGGGTATTGTCGCCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-1091s1c1
Sequence:CCGGGCTGAATTTCCGTACCACATTCTCGAGAATGTGGTACGGAAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-1079s1c1
Sequence:CCGGCCTTGACATTGTGCTGAATTTCTCGAGAAATTCAGCACAATGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012284.1-3516s1c1
Sequence:CCGGCCAGCCCTAGAACTCAGCGTTCTCGAGAACGCTGAGTTCTAGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-3121s1c1
Sequence:CCGGGCTCTGTCTTGAGTGGGACTTCTCGAGAAGTCCCACTCAAGACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-588s1c1
Sequence:CCGGCTCCTGGATGTGATACCCATACTCGAGTATGGGTATCACATCCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012284.1-859s21c1
Sequence:CCGGCAAACTTGCCTGAGTACAAAGCTCGAGCTTTGTACTCAGGCAAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012284.1-733s21c1
Sequence:CCGGCACGATCCAAAGGCTTCAATGCTCGAGCATTGAAGCCTTTGGATCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012284
KCNH3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012284.1-2414s21c1
Sequence:CCGGGAGCGGCGACAATACCCTTATCTCGAGATAAGGGTATTGTCGCCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-1091s1c1
Sequence:CCGGGCTGAATTTCCGTACCACATTCTCGAGAATGTGGTACGGAAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-1079s1c1
Sequence:CCGGCCTTGACATTGTGCTGAATTTCTCGAGAAATTCAGCACAATGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012284.1-3516s1c1
Sequence:CCGGCCAGCCCTAGAACTCAGCGTTCTCGAGAACGCTGAGTTCTAGGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-3121s1c1
Sequence:CCGGGCTCTGTCTTGAGTGGGACTTCTCGAGAAGTCCCACTCAAGACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012284.1-588s1c1
Sequence:CCGGCTCCTGGATGTGATACCCATACTCGAGTATGGGTATCACATCCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012284.1-859s21c1
Sequence:CCGGCAAACTTGCCTGAGTACAAAGCTCGAGCTTTGTACTCAGGCAAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012284.1-733s21c1
Sequence:CCGGCACGATCCAAAGGCTTCAATGCTCGAGCATTGAAGCCTTTGGATCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010601
KCNH3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-330s1c1
Sequence:CCGGCCTGGATGTGATACCTATAAACTCGAGTTTATAGGTATCACATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-608s1c1
Sequence:CCGGCTGAATATAAAGTCGCTGCTACTCGAGTAGCAGCGACTTTATATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-1672s1c1
Sequence:CCGGGCTGTGAACAATGGCATCGATCTCGAGATCGATGCCATTGTTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-3008s1c1
Sequence:CCGGCAGCTTTATGGACCTCCACTTCTCGAGAAGTGGAGGTCCATAAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-943s1c1
Sequence:CCGGCTGCCCTTTGACCTACTACATCTCGAGATGTAGTAGGTCAAAGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010601
KCNH3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-330s1c1
Sequence:CCGGCCTGGATGTGATACCTATAAACTCGAGTTTATAGGTATCACATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-608s1c1
Sequence:CCGGCTGAATATAAAGTCGCTGCTACTCGAGTAGCAGCGACTTTATATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-1672s1c1
Sequence:CCGGGCTGTGAACAATGGCATCGATCTCGAGATCGATGCCATTGTTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-3008s1c1
Sequence:CCGGCAGCTTTATGGACCTCCACTTCTCGAGAAGTGGAGGTCCATAAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-943s1c1
Sequence:CCGGCTGCCCTTTGACCTACTACATCTCGAGATGTAGTAGGTCAAAGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010601
KCNH3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-330s1c1
Sequence:CCGGCCTGGATGTGATACCTATAAACTCGAGTTTATAGGTATCACATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-608s1c1
Sequence:CCGGCTGAATATAAAGTCGCTGCTACTCGAGTAGCAGCGACTTTATATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-1672s1c1
Sequence:CCGGGCTGTGAACAATGGCATCGATCTCGAGATCGATGCCATTGTTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-3008s1c1
Sequence:CCGGCAGCTTTATGGACCTCCACTTCTCGAGAAGTGGAGGTCCATAAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010601.2-943s1c1
Sequence:CCGGCTGCCCTTTGACCTACTACATCTCGAGATGTAGTAGGTCAAAGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)