EMAIL THIS PAGE TO A FRIEND

KCNH4

potassium voltage-gated channel, subfamily H (eag-related), member 4

90 Gene Product Result for
Synonyms: BEC2 ELK1 Kv12.3
UniProtKB ID: Q9UQ05
Gene ID:
Human(23415) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]
Mouse(380728) potassium voltage-gated channel, subfamily H (eag-related), member 4
Rat(114032) potassium voltage-gated channel, subfamily H (eag-related), member 4
domestic guinea pig(100717085) potassium voltage-gated channel, subfamily H (eag-related), member 4
naked mole-rat(101725732) potassium voltage-gated channel, subfamily H (eag-related), member 4
sheep(101110253) potassium voltage-gated channel, subfamily H (eag-related), member 4
Zebrafish(567442) potassium voltage-gated channel, subfamily H (eag-related), member 4
chicken(772091) potassium voltage-gated channel, subfamily H (eag-related), member 4
cow(535907) potassium voltage-gated channel, subfamily H (eag-related), member 4
domestic cat(101095210) potassium voltage-gated channel, subfamily H (eag-related), member 4
dog(607649) potassium voltage-gated channel, subfamily H (eag-related), member 4
Zebrafish(100148126) potassium voltage-gated channel, subfamily H (eag-related), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301730 ANTI-KCNH4 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_354643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_354643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_354643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012285 Rosetta Predictions human pricing
NM_053630 Rosetta Predictions rat pricing
NM_001081194 Rosetta Predictions mouse pricing
XM_354643 Rosetta Predictions mouse pricing
XR_005007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344025 predicted 3177
2 SASI_Hs01_00198509 predicted 662
3 SASI_Hs01_00198510 predicted 1284
4 SASI_Hs01_00198512 predicted 718
5 SASI_Hs02_00344026 predicted 819
6 SASI_Hs01_00198513 predicted 1603
7 SASI_Hs01_00198514 predicted 1949
8 SASI_Hs01_00198516 predicted 1222
9 SASI_Hs01_00198517 predicted 615
10 SASI_Hs01_00198518 predicted 725
11 SASI_Hs01_00198511 predicted 926
12 SASI_Hs01_00198515 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045581 predicted 1931
2 SASI_Rn01_00045582 predicted 516
3 SASI_Rn01_00045583 predicted 1677
4 SASI_Rn01_00045584 predicted 2703
5 SASI_Rn01_00045585 predicted 1073
6 SASI_Rn01_00045587 predicted 2225
7 SASI_Rn01_00045588 predicted 1465
8 SASI_Rn01_00045590 predicted 721
9 SASI_Rn02_00266342 predicted 2071
10 SASI_Rn02_00266343 predicted 209
11 SASI_Rn01_00045586 predicted 2791
12 SASI_Rn01_00045589 predicted 2265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296111 predicted 2651
2 SASI_Mm02_00296112 predicted 1569
3 SASI_Mm02_00296113 predicted 2138
4 SASI_Mm02_00296114 predicted 470
5 SASI_Mm02_00296115 predicted 934
6 SASI_Mm02_00296116 predicted 950
7 SASI_Mm02_00296117 predicted 1044
8 SASI_Mm02_00296118 predicted 1617
9 SASI_Mm02_00296119 predicted 1626
10 SASI_Mm02_00296120 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205154 predicted 567
2 SASI_Mm01_00205155 predicted 1570
3 SASI_Mm01_00205156 predicted 477
4 SASI_Mm01_00205157 predicted 390
5 SASI_Mm01_00205158 predicted 936
6 SASI_Mm01_00205159 predicted 956
7 SASI_Mm01_00205160 predicted 893
8 SASI_Mm01_00205161 predicted 1042
9 SASI_Mm01_00205162 predicted 583
10 SASI_Mm01_00205163 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275812 predicted 571
2 SASI_Mm01_00275813 predicted 1572
3 SASI_Mm01_00275814 predicted 473
4 SASI_Mm01_00275815 predicted 381
5 SASI_Mm01_00275816 predicted 935
6 SASI_Mm01_00275817 predicted 948
7 SASI_Mm01_00275818 predicted 898
8 SASI_Mm01_00275819 predicted 1043
9 SASI_Mm01_00275820 predicted 585
10 SASI_Mm01_00275821 predicted 1627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012285
KCNH4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012285.2-908s21c1
Sequence:CCGGAGGCCAATAATAACGTGTTTGCTCGAGCAAACACGTTATTATTGGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012285.2-1857s21c1
Sequence:CCGGCAAGCAGCGCATGCTCGAATACTCGAGTATTCGAGCATGCGCTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012285.2-2099s21c1
Sequence:CCGGCCCTGCAGGCACATTACTATGCTCGAGCATAGTAATGTGCCTGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012285.2-3533s21c1
Sequence:CCGGGTGGTTACCTCTGACGCTATTCTCGAGAATAGCGTCAGAGGTAACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012285.1-1158s1c1
Sequence:CCGGCCTAGATATCATCCTGAACTTCTCGAGAAGTTCAGGATGATATCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012285
KCNH4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012285.2-908s21c1
Sequence:CCGGAGGCCAATAATAACGTGTTTGCTCGAGCAAACACGTTATTATTGGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012285.2-1857s21c1
Sequence:CCGGCAAGCAGCGCATGCTCGAATACTCGAGTATTCGAGCATGCGCTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012285.2-2099s21c1
Sequence:CCGGCCCTGCAGGCACATTACTATGCTCGAGCATAGTAATGTGCCTGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012285.2-3533s21c1
Sequence:CCGGGTGGTTACCTCTGACGCTATTCTCGAGAATAGCGTCAGAGGTAACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012285.1-1158s1c1
Sequence:CCGGCCTAGATATCATCCTGAACTTCTCGAGAAGTTCAGGATGATATCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012285
KCNH4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012285.2-908s21c1
Sequence:CCGGAGGCCAATAATAACGTGTTTGCTCGAGCAAACACGTTATTATTGGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012285.2-1857s21c1
Sequence:CCGGCAAGCAGCGCATGCTCGAATACTCGAGTATTCGAGCATGCGCTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012285.2-2099s21c1
Sequence:CCGGCCCTGCAGGCACATTACTATGCTCGAGCATAGTAATGTGCCTGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012285.2-3533s21c1
Sequence:CCGGGTGGTTACCTCTGACGCTATTCTCGAGAATAGCGTCAGAGGTAACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012285.1-1158s1c1
Sequence:CCGGCCTAGATATCATCCTGAACTTCTCGAGAAGTTCAGGATGATATCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_354643
KCNH4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-804s1c1
Sequence:CCGGCGCTGTGGAAATGCTCTTCATCTCGAGATGAAGAGCATTTCCACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-1737s1c1
Sequence:CCGGCTTGCACATCAAGACCTCCTTCTCGAGAAGGAGGTCTTGATGTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-2506s1c1
Sequence:CCGGCGGATCGTGGATGGCATTGAACTCGAGTTCAATGCCATCCACGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-486s1c1
Sequence:CCGGCTCAAGACTTAGGTCCACGAACTCGAGTTCGTGGACCTAAGTCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-268s1c1
Sequence:CCGGCACCAAGAACACCGAACTGAACTCGAGTTCAGTTCGGTGTTCTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_354643
KCNH4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-804s1c1
Sequence:CCGGCGCTGTGGAAATGCTCTTCATCTCGAGATGAAGAGCATTTCCACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-1737s1c1
Sequence:CCGGCTTGCACATCAAGACCTCCTTCTCGAGAAGGAGGTCTTGATGTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-2506s1c1
Sequence:CCGGCGGATCGTGGATGGCATTGAACTCGAGTTCAATGCCATCCACGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-486s1c1
Sequence:CCGGCTCAAGACTTAGGTCCACGAACTCGAGTTCGTGGACCTAAGTCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-268s1c1
Sequence:CCGGCACCAAGAACACCGAACTGAACTCGAGTTCAGTTCGGTGTTCTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_354643
KCNH4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-804s1c1
Sequence:CCGGCGCTGTGGAAATGCTCTTCATCTCGAGATGAAGAGCATTTCCACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-1737s1c1
Sequence:CCGGCTTGCACATCAAGACCTCCTTCTCGAGAAGGAGGTCTTGATGTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-2506s1c1
Sequence:CCGGCGGATCGTGGATGGCATTGAACTCGAGTTCAATGCCATCCACGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-486s1c1
Sequence:CCGGCTCAAGACTTAGGTCCACGAACTCGAGTTCGTGGACCTAAGTCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354643.1-268s1c1
Sequence:CCGGCACCAAGAACACCGAACTGAACTCGAGTTCAGTTCGGTGTTCTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)