EMAIL THIS PAGE TO A FRIEND

KCNH5

potassium voltage-gated channel, subfamily H (eag-related), member 5

147 Gene Product Result for
Synonyms: EAG2 H-EAG2 Kv10.2 hEAG2
UniProtKB ID: Q8NCM2, C9JP98
Gene ID:
Human(27133) Summary: This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(238271) potassium voltage-gated channel, subfamily H (eag-related), member 5
Rat(171146) potassium voltage-gated channel, subfamily H (eag-related), member 5
Zebrafish(100331767) potassium voltage-gated channel, subfamily H (eag-related), member 5
chicken(423514) potassium voltage-gated channel, subfamily H (eag-related), member 5
dog(490724) potassium voltage-gated channel, subfamily H (eag-related), member 5
domestic cat(101084632) potassium voltage-gated channel, subfamily H (eag-related), member 5
cow(537813) potassium voltage-gated channel, subfamily H (eag-related), member 5
Horse(100051764) potassium voltage-gated channel, subfamily H (eag-related), member 5
sheep(101106850) potassium voltage-gated channel, subfamily H (eag-related), member 5
Domestic Rabbit(100350687) potassium voltage-gated channel, subfamily H (eag-related), member 5
domestic guinea pig(100714219) potassium voltage-gated channel, subfamily H (eag-related), member 5
naked mole-rat(101713389) potassium voltage-gated channel, subfamily H (eag-related), member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139318 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085141 MISSION® esiRNA esiRNA human KCNH5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139318 Rosetta Predictions human pricing
NM_172375 Rosetta Predictions human pricing
NM_172376 Rosetta Predictions human pricing
NM_133610 Rosetta Predictions rat pricing
NM_172805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107863 predicted 1054
2 SASI_Hs01_00107864 predicted 733
3 SASI_Hs01_00107865 predicted 1158
4 SASI_Hs01_00107866 predicted 1176
5 SASI_Hs01_00107868 predicted 370
6 SASI_Hs01_00107869 predicted 1637
7 SASI_Hs01_00107870 predicted 427
8 SASI_Hs02_00364286 predicted 323
9 SASI_Hs01_00107871 predicted 1649
10 SASI_Hs01_00107872 predicted 1168
11 SASI_Hs01_00107867 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100531 predicted 1049
2 SASI_Hs01_00100532 predicted 729
3 SASI_Hs01_00100533 predicted 1156
4 SASI_Hs01_00100534 predicted 1184
5 SASI_Hs01_00100536 predicted 370
6 SASI_Hs01_00100537 predicted 1639
7 SASI_Hs01_00100538 predicted 423
8 SASI_Hs02_00368028 predicted 330
9 SASI_Hs01_00100539 predicted 1647
10 SASI_Hs01_00100540 predicted 1166
11 SASI_Hs01_00100535 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053507 predicted 991
2 SASI_Hs01_00053508 predicted 671
3 SASI_Hs01_00053509 predicted 1100
4 SASI_Hs01_00053510 predicted 1124
5 SASI_Hs01_00053512 predicted 317
6 SASI_Hs01_00053513 predicted 1582
7 SASI_Hs01_00053514 predicted 371
8 SASI_Hs02_00368029 predicted 272
9 SASI_Hs01_00053515 predicted 1588
10 SASI_Hs01_00053516 predicted 1110
11 SASI_Hs01_00053511 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103870 predicted 865
2 SASI_Rn01_00103871 predicted 1700
3 SASI_Rn01_00103872 predicted 880
4 SASI_Rn01_00103873 predicted 1854
5 SASI_Rn01_00103874 predicted 958
6 SASI_Rn01_00103875 predicted 1278
7 SASI_Rn01_00103876 predicted 1264
8 SASI_Rn01_00103877 predicted 1133
9 SASI_Rn02_00267835 predicted 2748
10 SASI_Rn02_00267836 predicted 2228
11 SASI_Rn01_00103878 predicted 831
12 SASI_Rn01_00103879 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146694 predicted 2329
2 SASI_Mm01_00146695 predicted 1394
3 SASI_Mm01_00146696 predicted 1410
4 SASI_Mm01_00146697 predicted 1909
5 SASI_Mm01_00146698 predicted 1813
6 SASI_Mm01_00146699 predicted 2392
7 SASI_Mm01_00146700 predicted 1485
8 SASI_Mm01_00146701 predicted 1801
9 SASI_Mm01_00146702 predicted 2316
10 SASI_Mm01_00146703 predicted 1331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172805
KCNH5 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172805.1-3871s1c1
Sequence:CCGGGCTTTCAATATGATGAACACACTCGAGTGTGTTCATCATATTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-3693s1c1
Sequence:CCGGCCCAAATACCATGTCAGGATACTCGAGTATCCTGACATGGTATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-2088s1c1
Sequence:CCGGCGAGCCTTACAACCATAGGATCTCGAGATCCTATGGTTGTAAGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-2243s1c1
Sequence:CCGGCGTTACCATGAGATGCTGAATCTCGAGATTCAGCATCTCATGGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-2492s1c1
Sequence:CCGGGCAGTGGAGTTCCAAACCATTCTCGAGAATGGTTTGGAACTCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172805.3-1127s21c1
Sequence:CCGGACATGCAAATCGCACCAATAACTCGAGTTATTGGTGCGATTTGCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172805.3-1556s21c1
Sequence:CCGGACAGTGTGGTGGACGTGATTTCTCGAGAAATCACGTCCACCACACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172805
KCNH5 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172805.1-3871s1c1
Sequence:CCGGGCTTTCAATATGATGAACACACTCGAGTGTGTTCATCATATTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-3693s1c1
Sequence:CCGGCCCAAATACCATGTCAGGATACTCGAGTATCCTGACATGGTATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-2088s1c1
Sequence:CCGGCGAGCCTTACAACCATAGGATCTCGAGATCCTATGGTTGTAAGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-2243s1c1
Sequence:CCGGCGTTACCATGAGATGCTGAATCTCGAGATTCAGCATCTCATGGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-2492s1c1
Sequence:CCGGGCAGTGGAGTTCCAAACCATTCTCGAGAATGGTTTGGAACTCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172805.3-1127s21c1
Sequence:CCGGACATGCAAATCGCACCAATAACTCGAGTTATTGGTGCGATTTGCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172805.3-1556s21c1
Sequence:CCGGACAGTGTGGTGGACGTGATTTCTCGAGAAATCACGTCCACCACACTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172805
KCNH5 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172805.1-3871s1c1
Sequence:CCGGGCTTTCAATATGATGAACACACTCGAGTGTGTTCATCATATTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-3693s1c1
Sequence:CCGGCCCAAATACCATGTCAGGATACTCGAGTATCCTGACATGGTATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-2088s1c1
Sequence:CCGGCGAGCCTTACAACCATAGGATCTCGAGATCCTATGGTTGTAAGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-2243s1c1
Sequence:CCGGCGTTACCATGAGATGCTGAATCTCGAGATTCAGCATCTCATGGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172805.1-2492s1c1
Sequence:CCGGGCAGTGGAGTTCCAAACCATTCTCGAGAATGGTTTGGAACTCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172805.3-1127s21c1
Sequence:CCGGACATGCAAATCGCACCAATAACTCGAGTTATTGGTGCGATTTGCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172805.3-1556s21c1
Sequence:CCGGACAGTGTGGTGGACGTGATTTCTCGAGAAATCACGTCCACCACACTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139318
KCNH5 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-1738s1c1
Sequence:CCGGGCGGTAGAGTTCCAAACCATTCTCGAGAATGGTTTGGAACTCTACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-1503s1c1
Sequence:CCGGGCTGAATAATGTACGGGACTTCTCGAGAAGTCCCGTACATTATTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-423s1c1
Sequence:CCGGCCTGTGTACTTTCAAGGATATCTCGAGATATCCTTGAAAGTACACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-2484s1c1
Sequence:CCGGGCTGCGACTCAAGAATAATATCTCGAGATATTATTCTTGAGTCGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-1160s21c1
Sequence:CCGGTCGGAGACTACGAGGTCATTGCTCGAGCAATGACCTCGTAGTCTCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-374s21c1
Sequence:CCGGATATGCAAATTGCACCAATAACTCGAGTTATTGGTGCAATTTGCATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-1241s21c1
Sequence:CCGGGGACTCCATATCGCTACAATACTCGAGTATTGTAGCGATATGGAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-803s21c1
Sequence:CCGGATAGTGTGGTGGACGTTATTTCTCGAGAAATAACGTCCACCACACTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139318
KCNH5 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-1738s1c1
Sequence:CCGGGCGGTAGAGTTCCAAACCATTCTCGAGAATGGTTTGGAACTCTACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-1503s1c1
Sequence:CCGGGCTGAATAATGTACGGGACTTCTCGAGAAGTCCCGTACATTATTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-423s1c1
Sequence:CCGGCCTGTGTACTTTCAAGGATATCTCGAGATATCCTTGAAAGTACACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-2484s1c1
Sequence:CCGGGCTGCGACTCAAGAATAATATCTCGAGATATTATTCTTGAGTCGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-1160s21c1
Sequence:CCGGTCGGAGACTACGAGGTCATTGCTCGAGCAATGACCTCGTAGTCTCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-374s21c1
Sequence:CCGGATATGCAAATTGCACCAATAACTCGAGTTATTGGTGCAATTTGCATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-1241s21c1
Sequence:CCGGGGACTCCATATCGCTACAATACTCGAGTATTGTAGCGATATGGAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-803s21c1
Sequence:CCGGATAGTGTGGTGGACGTTATTTCTCGAGAAATAACGTCCACCACACTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139318
KCNH5 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-1738s1c1
Sequence:CCGGGCGGTAGAGTTCCAAACCATTCTCGAGAATGGTTTGGAACTCTACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-1503s1c1
Sequence:CCGGGCTGAATAATGTACGGGACTTCTCGAGAAGTCCCGTACATTATTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-423s1c1
Sequence:CCGGCCTGTGTACTTTCAAGGATATCTCGAGATATCCTTGAAAGTACACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139318.3-2484s1c1
Sequence:CCGGGCTGCGACTCAAGAATAATATCTCGAGATATTATTCTTGAGTCGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-1160s21c1
Sequence:CCGGTCGGAGACTACGAGGTCATTGCTCGAGCAATGACCTCGTAGTCTCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-374s21c1
Sequence:CCGGATATGCAAATTGCACCAATAACTCGAGTTATTGGTGCAATTTGCATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-1241s21c1
Sequence:CCGGGGACTCCATATCGCTACAATACTCGAGTATTGTAGCGATATGGAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139318.3-803s21c1
Sequence:CCGGATAGTGTGGTGGACGTTATTTCTCGAGAAATAACGTCCACCACACTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)