EMAIL THIS PAGE TO A FRIEND

KCNH6

potassium voltage-gated channel, subfamily H (eag-related), member 6

82 Gene Product Result for
Synonyms: ERG-2 ERG2 HERG2 Kv11.2 hERG-2
UniProtKB ID: Q9H252, Q9BRD7
Gene ID:
Human(81033) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Mouse(192775) potassium voltage-gated channel, subfamily H (eag-related), member 6
Rat(116745) potassium voltage-gated channel, subfamily H (eag-related), member 6
chicken(414871) potassium voltage-gated channel, subfamily H (eag-related), member 6
dog(610684) potassium voltage-gated channel, subfamily H (eag-related), member 6
Horse(100054322) potassium voltage-gated channel, subfamily H (eag-related), member 6
cow(527872) potassium voltage-gated channel, subfamily H (eag-related), member 6
domestic cat(101083379) potassium voltage-gated channel, subfamily H (eag-related), member 6
domestic guinea pig(100734140) potassium voltage-gated channel, subfamily H (eag-related), member 6
naked mole-rat(101702881) potassium voltage-gated channel, subfamily H (eag-related), member 6
sheep(101102319) potassium voltage-gated channel, subfamily H (eag-related), member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
D7148 3,4-Diaminopyridine ≥98% human pricing
36687 4-Aminopyridine PESTANAL®, analytical standard human pricing
1162454 Dalfampridine United States Pharmacopeia (USP) Reference Standard human pricing
PH016683 Guanidine AldrichCPR human pricing
G11659 Guanidine carbonate salt 99% human pricing
50930 Guanidine carbonate salt purum, ≥97.0% (NT) human pricing
G3272 Guanidine hydrochloride for molecular biology, ≥99% human pricing
G4505 Guanidine hydrochloride organic base and chaeotropic agent, ≥99% (titration) human pricing
50950 Guanidine hydrochloride ≥98% human pricing
PHG0006 Guanidine hydrochloride PharmaGrade, Manufactured under appropriate controls for use as a raw material in pharma or biopharmaceutical production. human pricing
50933 Guanidine hydrochloride BioUltra, for molecular biology, ≥99.5% (AT) human pricing
RDD001 Guanidine hydrochloride anhydrous, free-flowing, Redi-Dri, ≥99% human pricing
50940 Guanidine hydrochloride ≥99.0% (AT) human pricing
V900385 Guanidine hydrochloride Vetec reagent grade, ≥98% human pricing
12-1660 Guanidine hydrochloride SAJ special grade, ≥99.0% human pricing
12-1665 Guanidine hydrochloride ≥99.5% human pricing
G11705 Guanidine hydrochloride 92% human pricing
G7153 Guanidine hydrochloride BioXtra, ≥99.5% (titration) human pricing
G4630 Guanidine hydrochloride ≥98% human pricing
G9284 Guanidine hydrochloride solution human pricing
50937 Guanidine hydrochloride solution BioUltra, ~8 M in H2O human pricing
275875 4-Aminopyridine ≥99% human, mouse, rat pricing
A78403 4-Aminopyridine 98% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030779 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_112511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_112511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_112511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030779 Rosetta Predictions human pricing
NM_173092 Rosetta Predictions human pricing
NM_053937 Rosetta Predictions rat pricing
NM_001037712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033447 predicted 605
2 SASI_Hs01_00033448 predicted 2793
3 SASI_Hs01_00033449 predicted 771
4 SASI_Hs01_00033450 predicted 2774
5 SASI_Hs01_00033452 predicted 362
6 SASI_Hs01_00033453 predicted 2076
7 SASI_Hs01_00033454 predicted 723
8 SASI_Hs01_00033455 predicted 3055
9 SASI_Hs02_00358321 predicted 3019
10 SASI_Hs02_00358322 predicted 1184
11 SASI_Hs01_00033446 predicted 1750
12 SASI_Hs01_00033451 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097949 predicted 602
2 SASI_Hs01_00097950 predicted 2525
3 SASI_Hs01_00097951 predicted 766
4 SASI_Hs01_00097952 predicted 2505
5 SASI_Hs01_00097954 predicted 362
6 SASI_Hs01_00097955 predicted 1919
7 SASI_Hs01_00097956 predicted 723
8 SASI_Hs01_00097957 predicted 2783
9 SASI_Hs02_00368117 predicted 2755
10 SASI_Hs02_00368118 predicted 1184
11 SASI_Hs01_00097948 predicted 1597
12 SASI_Hs01_00097953 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056119 predicted 719
2 SASI_Rn01_00056120 predicted 2909
3 SASI_Rn01_00056121 predicted 2552
4 SASI_Rn02_00266892 predicted 2626
5 SASI_Rn01_00056124 predicted 582
6 SASI_Rn02_00266893 predicted 1137
7 SASI_Rn01_00056125 predicted 811
8 SASI_Rn01_00056126 predicted 2298
9 SASI_Rn01_00056127 predicted 2113
10 SASI_Rn02_00266894 predicted 855
11 SASI_Rn01_00056122 predicted 1491
12 SASI_Rn01_00056123 predicted 2616
13 SASI_Rn01_00056128 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167710 predicted 1942
2 SASI_Mm01_00167711 predicted 2571
3 SASI_Mm01_00167712 predicted 432
4 SASI_Mm01_00167713 predicted 723
5 SASI_Mm01_00167714 predicted 1490
6 SASI_Mm01_00167715 predicted 1470
7 SASI_Mm01_00167716 predicted 1571
8 SASI_Mm01_00167717 predicted 2545
9 SASI_Mm01_00167718 predicted 1259
10 SASI_Mm01_00167719 predicted 2257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030779
KCNH6 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030779.2-3099s21c1
Sequence:CCGGGGTGGGCAAGGTGAGAGTTAACTCGAGTTAACTCTCACCTTGCCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030779.2-2465s21c1
Sequence:CCGGGCCTGAGCTACTGCAGGAAATCTCGAGATTTCCTGCAGTAGCTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030779.2-3059s21c1
Sequence:CCGGCCACTGAACTCCAAGATAAAGCTCGAGCTTTATCTTGGAGTTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-2933s1c1
Sequence:CCGGCCTGGAAGTACAAGGACTCATCTCGAGATGAGTCCTTGTACTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-1361s1c1
Sequence:CCGGGCCCTACCTAGAACACAAGATCTCGAGATCTTGTGTTCTAGGTAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-2775s1c1
Sequence:CCGGCCAAGCTATGGAGACTTGGATCTCGAGATCCAAGTCTCCATAGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-146s1c1
Sequence:CCGGCGAGGGCCAAAGTCGGAAGTTCTCGAGAACTTCCGACTTTGGCCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-644s1c1
Sequence:CCGGCGTGGAGTTCAACTTGGAGAACTCGAGTTCTCCAAGTTGAACTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030779
KCNH6 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030779.2-3099s21c1
Sequence:CCGGGGTGGGCAAGGTGAGAGTTAACTCGAGTTAACTCTCACCTTGCCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030779.2-2465s21c1
Sequence:CCGGGCCTGAGCTACTGCAGGAAATCTCGAGATTTCCTGCAGTAGCTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030779.2-3059s21c1
Sequence:CCGGCCACTGAACTCCAAGATAAAGCTCGAGCTTTATCTTGGAGTTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-2933s1c1
Sequence:CCGGCCTGGAAGTACAAGGACTCATCTCGAGATGAGTCCTTGTACTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-1361s1c1
Sequence:CCGGGCCCTACCTAGAACACAAGATCTCGAGATCTTGTGTTCTAGGTAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-2775s1c1
Sequence:CCGGCCAAGCTATGGAGACTTGGATCTCGAGATCCAAGTCTCCATAGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-146s1c1
Sequence:CCGGCGAGGGCCAAAGTCGGAAGTTCTCGAGAACTTCCGACTTTGGCCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-644s1c1
Sequence:CCGGCGTGGAGTTCAACTTGGAGAACTCGAGTTCTCCAAGTTGAACTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030779
KCNH6 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030779.2-3099s21c1
Sequence:CCGGGGTGGGCAAGGTGAGAGTTAACTCGAGTTAACTCTCACCTTGCCCACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000442901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030779.2-2465s21c1
Sequence:CCGGGCCTGAGCTACTGCAGGAAATCTCGAGATTTCCTGCAGTAGCTCAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030779.2-3059s21c1
Sequence:CCGGCCACTGAACTCCAAGATAAAGCTCGAGCTTTATCTTGGAGTTCAGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-2933s1c1
Sequence:CCGGCCTGGAAGTACAAGGACTCATCTCGAGATGAGTCCTTGTACTTCCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-1361s1c1
Sequence:CCGGGCCCTACCTAGAACACAAGATCTCGAGATCTTGTGTTCTAGGTAGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-2775s1c1
Sequence:CCGGCCAAGCTATGGAGACTTGGATCTCGAGATCCAAGTCTCCATAGCTTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-146s1c1
Sequence:CCGGCGAGGGCCAAAGTCGGAAGTTCTCGAGAACTTCCGACTTTGGCCCTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030779.2-644s1c1
Sequence:CCGGCGTGGAGTTCAACTTGGAGAACTCGAGTTCTCCAAGTTGAACTCCACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_112511
KCNH6 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-1555s1c1
Sequence:CCGGCCCTCTGTCCAAGACAAGTATCTCGAGATACTTGTCTTGGACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-2432s1c1
Sequence:CCGGCCCTGAGCATTTCAGACACATCTCGAGATGTGTCTGAAATGCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-79s1c1
Sequence:CCGGCGTAAGTTCCTGATTGCCAATCTCGAGATTGGCAATCAGGAACTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-2757s1c1
Sequence:CCGGGACCCTAAGCTATGGTGATTTCTCGAGAAATCACCATAGCTTAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-673s1c1
Sequence:CCGGCGGACACAGAATGTCACTGAACTCGAGTTCAGTGACATTCTGTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_112511
KCNH6 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-1555s1c1
Sequence:CCGGCCCTCTGTCCAAGACAAGTATCTCGAGATACTTGTCTTGGACAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-2432s1c1
Sequence:CCGGCCCTGAGCATTTCAGACACATCTCGAGATGTGTCTGAAATGCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-79s1c1
Sequence:CCGGCGTAAGTTCCTGATTGCCAATCTCGAGATTGGCAATCAGGAACTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-2757s1c1
Sequence:CCGGGACCCTAAGCTATGGTGATTTCTCGAGAAATCACCATAGCTTAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-673s1c1
Sequence:CCGGCGGACACAGAATGTCACTGAACTCGAGTTCAGTGACATTCTGTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_112511
KCNH6 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-1555s1c1
Sequence:CCGGCCCTCTGTCCAAGACAAGTATCTCGAGATACTTGTCTTGGACAGAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-2432s1c1
Sequence:CCGGCCCTGAGCATTTCAGACACATCTCGAGATGTGTCTGAAATGCTCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-79s1c1
Sequence:CCGGCGTAAGTTCCTGATTGCCAATCTCGAGATTGGCAATCAGGAACTTACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-2757s1c1
Sequence:CCGGGACCCTAAGCTATGGTGATTTCTCGAGAAATCACCATAGCTTAGGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112511.2-673s1c1
Sequence:CCGGCGGACACAGAATGTCACTGAACTCGAGTTCAGTGACATTCTGTGTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???