EMAIL THIS PAGE TO A FRIEND

KCNH7

potassium voltage-gated channel, subfamily H (eag-related), member 7

107 Gene Product Result for
Synonyms: ERG3 HERG3 Kv11.3
UniProtKB ID: Q9NS40, Q53QU4, Q53TB7, Q53TP9, Q8IV15
Gene ID:
Human(90134) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(170738) potassium voltage-gated channel, subfamily H (eag-related), member 7
Rat(170739) potassium voltage-gated channel, subfamily H (eag-related), member 7
sheep(101105723) potassium voltage-gated channel, subfamily H (eag-related), member 7
Domestic Rabbit(100345329) potassium voltage-gated channel, subfamily H (eag-related), member 7
domestic guinea pig(100720014) potassium voltage-gated channel, subfamily H (eag-related), member 7
naked mole-rat(101719176) potassium voltage-gated channel, subfamily H (eag-related), member 7
chicken(424184) potassium voltage-gated channel, subfamily H (eag-related), member 7
Horse(100051695) potassium voltage-gated channel, subfamily H (eag-related), member 7
domestic cat(101098320) potassium voltage-gated channel, subfamily H (eag-related), member 7
dog(478768) potassium voltage-gated channel, subfamily H (eag-related), member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033272 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063421 MISSION® esiRNA esiRNA human KCNH7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033272 Rosetta Predictions human pricing
NM_173162 Rosetta Predictions human pricing
NM_131912 Rosetta Predictions rat pricing
NM_133207 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165318 predicted 1543
2 SASI_Hs01_00165319 predicted 1528
3 SASI_Hs01_00165320 predicted 2015
4 SASI_Hs01_00165322 predicted 2042
5 SASI_Hs01_00165323 predicted 688
6 SASI_Hs01_00165324 predicted 782
7 SASI_Hs01_00165325 predicted 481
8 SASI_Hs02_00361065 predicted 1462
9 SASI_Hs01_00165326 predicted 1982
10 SASI_Hs02_00361066 predicted 702
11 SASI_Hs01_00165321 predicted 1859
12 SASI_Hs01_00165327 predicted 1827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046855 predicted 1522
2 SASI_Hs01_00046856 predicted 1507
3 SASI_Hs01_00046857 predicted 1990
4 SASI_Hs01_00046859 predicted 2017
5 SASI_Hs01_00046860 predicted 684
6 SASI_Hs01_00046861 predicted 776
7 SASI_Hs01_00046862 predicted 484
8 SASI_Hs02_00368131 predicted 1441
9 SASI_Hs01_00046863 predicted 1963
10 SASI_Hs02_00368132 predicted 699
11 SASI_Hs01_00046858 predicted 1836
12 SASI_Hs01_00046864 predicted 1808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074576 predicted 3543
2 SASI_Rn02_00267541 predicted 1496
3 SASI_Rn02_00267542 predicted 2697
4 SASI_Rn02_00267543 predicted 1063
5 SASI_Rn01_00074579 predicted 2078
6 SASI_Rn01_00074580 predicted 1833
7 SASI_Rn01_00074581 predicted 2708
8 SASI_Rn01_00074583 predicted 1976
9 SASI_Rn01_00074584 predicted 1156
10 SASI_Rn01_00074585 predicted 1729
11 SASI_Rn01_00074577 predicted 452
12 SASI_Rn01_00074578 predicted 665
13 SASI_Rn01_00074582 predicted 2942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169442 predicted 1529
2 SASI_Mm01_00169444 predicted 2931
3 SASI_Mm01_00169445 predicted 2332
4 SASI_Mm01_00169446 predicted 1089
5 SASI_Mm01_00169447 predicted 2106
6 SASI_Mm01_00169450 predicted 2044
7 SASI_Mm02_00338400 predicted 685
8 SASI_Mm01_00169451 predicted 2662
9 SASI_Mm02_00338401 predicted 2967
10 SASI_Mm02_00338402 predicted 2034
11 SASI_Mm01_00169443 predicted 287
12 SASI_Mm01_00169448 predicted 2165
13 SASI_Mm01_00169449 predicted 3307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133207
KCNH7 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-2830s1c1
Sequence:CCGGCCTCCATTGATGATGAGCAAACTCGAGTTTGCTCATCATCAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-873s1c1
Sequence:CCGGCCCAAGAACATATTTAGAGATCTCGAGATCTCTAAATATGTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-3342s1c1
Sequence:CCGGCCTGAATTTCTCGACCTCGAACTCGAGTTCGAGGTCGAGAAATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-75s1c1
Sequence:CCGGCGGAAATTTGAAGGGCAGAATCTCGAGATTCTGCCCTTCAAATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-2213s1c1
Sequence:CCGGCCTGCATCTGAACCAGACTTTCTCGAGAAAGTCTGGTTCAGATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-746s21c1
Sequence:CCGGACCCGGATGTGGTAGTTATTGCTCGAGCAATAACTACCACATCCGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-1572s21c1
Sequence:CCGGAGACTTGATTGTGGATATTATCTCGAGATAATATCCACAATCAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-2023s21c1
Sequence:CCGGAGTTCTGGACCGTCCATTAAACTCGAGTTTAATGGACGGTCCAGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-2188s21c1
Sequence:CCGGGGGAACGTTTCTGCAATTATTCTCGAGAATAATTGCAGAAACGTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-634s21c1
Sequence:CCGGGAGAGGGTCAACCCGATATTACTCGAGTAATATCGGGTTGACCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133207
KCNH7 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-2830s1c1
Sequence:CCGGCCTCCATTGATGATGAGCAAACTCGAGTTTGCTCATCATCAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-873s1c1
Sequence:CCGGCCCAAGAACATATTTAGAGATCTCGAGATCTCTAAATATGTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-3342s1c1
Sequence:CCGGCCTGAATTTCTCGACCTCGAACTCGAGTTCGAGGTCGAGAAATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-75s1c1
Sequence:CCGGCGGAAATTTGAAGGGCAGAATCTCGAGATTCTGCCCTTCAAATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-2213s1c1
Sequence:CCGGCCTGCATCTGAACCAGACTTTCTCGAGAAAGTCTGGTTCAGATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-746s21c1
Sequence:CCGGACCCGGATGTGGTAGTTATTGCTCGAGCAATAACTACCACATCCGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-1572s21c1
Sequence:CCGGAGACTTGATTGTGGATATTATCTCGAGATAATATCCACAATCAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-2023s21c1
Sequence:CCGGAGTTCTGGACCGTCCATTAAACTCGAGTTTAATGGACGGTCCAGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-2188s21c1
Sequence:CCGGGGGAACGTTTCTGCAATTATTCTCGAGAATAATTGCAGAAACGTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-634s21c1
Sequence:CCGGGAGAGGGTCAACCCGATATTACTCGAGTAATATCGGGTTGACCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133207
KCNH7 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-2830s1c1
Sequence:CCGGCCTCCATTGATGATGAGCAAACTCGAGTTTGCTCATCATCAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-873s1c1
Sequence:CCGGCCCAAGAACATATTTAGAGATCTCGAGATCTCTAAATATGTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-3342s1c1
Sequence:CCGGCCTGAATTTCTCGACCTCGAACTCGAGTTCGAGGTCGAGAAATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-75s1c1
Sequence:CCGGCGGAAATTTGAAGGGCAGAATCTCGAGATTCTGCCCTTCAAATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133207.1-2213s1c1
Sequence:CCGGCCTGCATCTGAACCAGACTTTCTCGAGAAAGTCTGGTTCAGATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-746s21c1
Sequence:CCGGACCCGGATGTGGTAGTTATTGCTCGAGCAATAACTACCACATCCGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-1572s21c1
Sequence:CCGGAGACTTGATTGTGGATATTATCTCGAGATAATATCCACAATCAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-2023s21c1
Sequence:CCGGAGTTCTGGACCGTCCATTAAACTCGAGTTTAATGGACGGTCCAGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-2188s21c1
Sequence:CCGGGGGAACGTTTCTGCAATTATTCTCGAGAATAATTGCAGAAACGTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133207.2-634s21c1
Sequence:CCGGGAGAGGGTCAACCCGATATTACTCGAGTAATATCGGGTTGACCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033272
KCNH7 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-1036s1c1
Sequence:CCGGCGGTCCATGATATAGAAGGATCTCGAGATCCTTCTATATCATGGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-841s1c1
Sequence:CCGGCCTCTGAAGCAGATGACACAACTCGAGTTGTGTCATCTGCTTCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-3028s1c1
Sequence:CCGGCCTCCATTGATGATGAACAAACTCGAGTTTGTTCATCATCAATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-3540s1c1
Sequence:CCGGCCTGAATTTCTAGACCTTGAACTCGAGTTCAAGGTCTAGAAATTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-1559s1c1
Sequence:CCGGCCCTTTGAATGTGGTAGACTTCTCGAGAAGTCTACCACATTCAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-258s21c1
Sequence:CCGGGGGACCATCATTCGGAAATTTCTCGAGAAATTTCCGAATGATGGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-1394s21c1
Sequence:CCGGCATCAACAAGTTTACGATATTCTCGAGAATATCGTAAACTTGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-2025s21c1
Sequence:CCGGAGTTCTGGACCATCCATTAAACTCGAGTTTAATGGATGGTCCAGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-598s21c1
Sequence:CCGGTTGAATATGTGACGGATAATGCTCGAGCATTATCCGTCACATATTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-636s21c1
Sequence:CCGGGAGAGGGTAAACCCAATATTACTCGAGTAATATTGGGTTTACCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033272
KCNH7 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-1036s1c1
Sequence:CCGGCGGTCCATGATATAGAAGGATCTCGAGATCCTTCTATATCATGGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-841s1c1
Sequence:CCGGCCTCTGAAGCAGATGACACAACTCGAGTTGTGTCATCTGCTTCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-3028s1c1
Sequence:CCGGCCTCCATTGATGATGAACAAACTCGAGTTTGTTCATCATCAATGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-3540s1c1
Sequence:CCGGCCTGAATTTCTAGACCTTGAACTCGAGTTCAAGGTCTAGAAATTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-1559s1c1
Sequence:CCGGCCCTTTGAATGTGGTAGACTTCTCGAGAAGTCTACCACATTCAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-258s21c1
Sequence:CCGGGGGACCATCATTCGGAAATTTCTCGAGAAATTTCCGAATGATGGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-1394s21c1
Sequence:CCGGCATCAACAAGTTTACGATATTCTCGAGAATATCGTAAACTTGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-2025s21c1
Sequence:CCGGAGTTCTGGACCATCCATTAAACTCGAGTTTAATGGATGGTCCAGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-598s21c1
Sequence:CCGGTTGAATATGTGACGGATAATGCTCGAGCATTATCCGTCACATATTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-636s21c1
Sequence:CCGGGAGAGGGTAAACCCAATATTACTCGAGTAATATTGGGTTTACCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033272
KCNH7 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-1036s1c1
Sequence:CCGGCGGTCCATGATATAGAAGGATCTCGAGATCCTTCTATATCATGGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-841s1c1
Sequence:CCGGCCTCTGAAGCAGATGACACAACTCGAGTTGTGTCATCTGCTTCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-3028s1c1
Sequence:CCGGCCTCCATTGATGATGAACAAACTCGAGTTTGTTCATCATCAATGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-3540s1c1
Sequence:CCGGCCTGAATTTCTAGACCTTGAACTCGAGTTCAAGGTCTAGAAATTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033272.2-1559s1c1
Sequence:CCGGCCCTTTGAATGTGGTAGACTTCTCGAGAAGTCTACCACATTCAAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-258s21c1
Sequence:CCGGGGGACCATCATTCGGAAATTTCTCGAGAAATTTCCGAATGATGGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-1394s21c1
Sequence:CCGGCATCAACAAGTTTACGATATTCTCGAGAATATCGTAAACTTGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-2025s21c1
Sequence:CCGGAGTTCTGGACCATCCATTAAACTCGAGTTTAATGGATGGTCCAGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-598s21c1
Sequence:CCGGTTGAATATGTGACGGATAATGCTCGAGCATTATCCGTCACATATTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033272.2-636s21c1
Sequence:CCGGGAGAGGGTAAACCCAATATTACTCGAGTAATATTGGGTTTACCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)