EMAIL THIS PAGE TO A FRIEND

KCNH8

potassium voltage-gated channel, subfamily H (eag-related), member 8

247 Gene Product Result for
Synonyms: ELK ELK1 Kv12.1 elk3
UniProtKB ID: Q96L42, Q59GQ6
Gene ID:
Human(131096) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Mouse(211468) potassium voltage-gated channel, subfamily H (eag-related), member 8
Rat(246325) potassium voltage-gated channel, subfamily H (eag-related), member 8
Zebrafish(100002967) potassium voltage-gated channel, subfamily H (eag-related), member 8
cow(618639) potassium voltage-gated channel, subfamily H (eag-related), member 8
cow(100336609) potassium voltage-gated channel, subfamily H (eag-related), member 8
Horse(100052056) potassium voltage-gated channel, subfamily H (eag-related), member 8
domestic cat(101099493) potassium voltage-gated channel, subfamily H (eag-related), member 8
dog(485649) potassium voltage-gated channel, subfamily H (eag-related), member 8
chicken(420648) potassium voltage-gated channel, subfamily H (eag-related), member 8
domestic guinea pig(100724073) potassium voltage-gated channel, subfamily H (eag-related), member 8
naked mole-rat(101697071) potassium voltage-gated channel, subfamily H (eag-related), member 8
sheep(101120717) potassium voltage-gated channel, subfamily H (eag-related), member 8
Domestic Rabbit(100349166) potassium voltage-gated channel, subfamily H (eag-related), member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001031811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001031811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144633 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144633 Rosetta Predictions human pricing
NM_145095 Rosetta Predictions rat pricing
NM_001031811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031529 predicted 274
2 SASI_Hs01_00031530 predicted 1446
3 SASI_Hs02_00364472 predicted 2696
4 SASI_Hs01_00031534 predicted 1821
5 SASI_Hs01_00031535 predicted 1796
6 SASI_Hs02_00364473 predicted 1771
7 SASI_Hs01_00031536 predicted 377
8 SASI_Hs01_00031537 predicted 1241
9 SASI_Hs02_00364474 predicted 1786
10 SASI_Hs01_00031538 predicted 1306
11 SASI_Hs01_00031531 predicted 2055
12 SASI_Hs01_00031532 predicted 580
13 SASI_Hs01_00031533 predicted 2828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057072 predicted 3384
2 SASI_Rn01_00057073 predicted 1826
3 SASI_Rn01_00057074 predicted 2282
4 SASI_Rn01_00057075 predicted 2401
5 SASI_Rn01_00057076 predicted 1905
6 SASI_Rn01_00057077 predicted 2962
7 SASI_Rn01_00057078 predicted 1773
8 SASI_Rn01_00057079 predicted 2077
9 SASI_Rn02_00268692 predicted 1590
10 SASI_Rn01_00057080 predicted 3338
11 SASI_Rn01_00057081 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156754 predicted 2964
2 SASI_Mm01_00156755 predicted 1586
3 SASI_Mm01_00156756 predicted 516
4 SASI_Mm01_00156757 predicted 3327
5 SASI_Mm01_00156758 predicted 1998
6 SASI_Mm01_00156759 predicted 1820
7 SASI_Mm01_00156760 predicted 1957
8 SASI_Mm01_00156761 predicted 419
9 SASI_Mm01_00156763 predicted 826
10 SASI_Mm02_00288160 predicted 2094
11 SASI_Mm01_00156762 predicted 3341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031811
KCNH8 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-1149s1c1
Sequence:CCGGGATGGCATGTATCTGGTATATCTCGAGATATACCAGATACATGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2216s1c1
Sequence:CCGGCCCTTTCTCCTATCTACACAACTCGAGTTGTGTAGATAGGAGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2666s1c1
Sequence:CCGGCAACATTAACTCAGGAGGTTTCTCGAGAAACCTCCTGAGTTAATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2144s1c1
Sequence:CCGGGCATCAACAAGAGACTCCCATCTCGAGATGGGAGTCTCTTGTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-111s1c1
Sequence:CCGGCGGAACACATAGCAACTTCATCTCGAGATGAAGTTGCTATGTGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-3332s1c1
Sequence:CCGGGCAAAGCCATAAACGTATAATCTCGAGATTATACGTTTATGGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2711s1c1
Sequence:CCGGGCATCATGCAACTTCTGGAAACTCGAGTTTCCAGAAGTTGCATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-381s1c1
Sequence:CCGGCGTTCCTATAAAGAATGAGAACTCGAGTTCTCATTCTTTATAGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031811
KCNH8 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-1149s1c1
Sequence:CCGGGATGGCATGTATCTGGTATATCTCGAGATATACCAGATACATGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2216s1c1
Sequence:CCGGCCCTTTCTCCTATCTACACAACTCGAGTTGTGTAGATAGGAGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2666s1c1
Sequence:CCGGCAACATTAACTCAGGAGGTTTCTCGAGAAACCTCCTGAGTTAATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2144s1c1
Sequence:CCGGGCATCAACAAGAGACTCCCATCTCGAGATGGGAGTCTCTTGTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-111s1c1
Sequence:CCGGCGGAACACATAGCAACTTCATCTCGAGATGAAGTTGCTATGTGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-3332s1c1
Sequence:CCGGGCAAAGCCATAAACGTATAATCTCGAGATTATACGTTTATGGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2711s1c1
Sequence:CCGGGCATCATGCAACTTCTGGAAACTCGAGTTTCCAGAAGTTGCATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-381s1c1
Sequence:CCGGCGTTCCTATAAAGAATGAGAACTCGAGTTCTCATTCTTTATAGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031811
KCNH8 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-1149s1c1
Sequence:CCGGGATGGCATGTATCTGGTATATCTCGAGATATACCAGATACATGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2216s1c1
Sequence:CCGGCCCTTTCTCCTATCTACACAACTCGAGTTGTGTAGATAGGAGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2666s1c1
Sequence:CCGGCAACATTAACTCAGGAGGTTTCTCGAGAAACCTCCTGAGTTAATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2144s1c1
Sequence:CCGGGCATCAACAAGAGACTCCCATCTCGAGATGGGAGTCTCTTGTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-111s1c1
Sequence:CCGGCGGAACACATAGCAACTTCATCTCGAGATGAAGTTGCTATGTGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-3332s1c1
Sequence:CCGGGCAAAGCCATAAACGTATAATCTCGAGATTATACGTTTATGGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-2711s1c1
Sequence:CCGGGCATCATGCAACTTCTGGAAACTCGAGTTTCCAGAAGTTGCATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031811.1-381s1c1
Sequence:CCGGCGTTCCTATAAAGAATGAGAACTCGAGTTCTCATTCTTTATAGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144633
KCNH8 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-2660s1c1
Sequence:CCGGGCAGTGAAGAAAGTCAGACTTCTCGAGAAGTCTGACTTTCTTCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-1638s1c1
Sequence:CCGGCCTCTATCACACTAGAACTAACTCGAGTTAGTTCTAGTGTGATAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-316s1c1
Sequence:CCGGCCCATAGTCTACTGTTCCGATCTCGAGATCGGAACAGTAGACTATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-2787s1c1
Sequence:CCGGGCAGCAGATAAACAAACTCAACTCGAGTTGAGTTTGTTTATCTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-1023s1c1
Sequence:CCGGCCGAACAACTTATGTCAGCAACTCGAGTTGCTGACATAAGTTGTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144633
KCNH8 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-2660s1c1
Sequence:CCGGGCAGTGAAGAAAGTCAGACTTCTCGAGAAGTCTGACTTTCTTCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-1638s1c1
Sequence:CCGGCCTCTATCACACTAGAACTAACTCGAGTTAGTTCTAGTGTGATAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-316s1c1
Sequence:CCGGCCCATAGTCTACTGTTCCGATCTCGAGATCGGAACAGTAGACTATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-2787s1c1
Sequence:CCGGGCAGCAGATAAACAAACTCAACTCGAGTTGAGTTTGTTTATCTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-1023s1c1
Sequence:CCGGCCGAACAACTTATGTCAGCAACTCGAGTTGCTGACATAAGTTGTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144633
KCNH8 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-2660s1c1
Sequence:CCGGGCAGTGAAGAAAGTCAGACTTCTCGAGAAGTCTGACTTTCTTCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-1638s1c1
Sequence:CCGGCCTCTATCACACTAGAACTAACTCGAGTTAGTTCTAGTGTGATAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-316s1c1
Sequence:CCGGCCCATAGTCTACTGTTCCGATCTCGAGATCGGAACAGTAGACTATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-2787s1c1
Sequence:CCGGGCAGCAGATAAACAAACTCAACTCGAGTTGAGTTTGTTTATCTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144633.2-1023s1c1
Sequence:CCGGCCGAACAACTTATGTCAGCAACTCGAGTTGCTGACATAAGTTGTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)