EMAIL THIS PAGE TO A FRIEND

KCNIP2

Kv channel interacting protein 2

277 Gene Product Result for
Synonyms: KCHIP2
Gene ID:
Human(30819) Summary: This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belongs to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified from this gene. [provided by RefSeq, Jul 2008]
Mouse(80906) Kv channel-interacting protein 2
Rat(56817) Kv channel-interacting protein 2
chicken(374098) Kv channel interacting protein 2
dog(403598) Kv channel interacting protein 2
Horse(100060206) Kv channel interacting protein 2
cow(540895) Kv channel interacting protein 2
domestic cat(101098895) Kv channel interacting protein 2
domestic guinea pig(100722651) Kv channel interacting protein 2
naked mole-rat(101703120) Kv channel interacting protein 2
sheep(101103859) Kv channel interacting protein 2
Domestic Rabbit(100009019) Kv channel interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101211 Anti-KCNIP2 (ab1) antibody produced in rabbit affinity isolated antibody mouse, rat, guinea pig, human, horse
western blot pricing
AV35488 Anti-KCNIP2 (AB1) antibody produced in rabbit affinity isolated antibody canine, rabbit, rabbit, mouse, human, zebrafish, rat, horse, bovine, guinea pig, pig
western blot pricing
SAB2101212 Anti-KCNIP2 (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, human, mouse, rat, rabbit, canine, horse
western blot pricing
AV35497 Anti-KCNIP2 (AB2) antibody produced in rabbit affinity isolated antibody pig, human, guinea pig, horse, rat, rabbit, zebrafish, rabbit, canine, mouse, bovine
immunohistochemistry, western blot pricing
SAB2101213 Anti-KCNIP2 (ab3) antibody produced in rabbit affinity isolated antibody guinea pig, rat, rabbit, zebrafish, human, horse, bovine, pig, rabbit, canine, mouse
western blot pricing
SAB1407408 Anti-KCNIP2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution rat, human
immunofluorescence, western blot pricing
SAB2104247 Anti-KCNIP2 antibody produced in rabbit affinity isolated antibody pig, human, guinea pig, horse, bovine, canine, mouse, rabbit, zebrafish, rabbit, rat
western blot pricing
SAB2103400 Anti-KCNIP2, (N-terminal) antibody produced in rabbit affinity isolated antibody human, rabbit
western blot pricing
SAB2104211 Anti-KCNIP2, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, human
western blot pricing
K4513 Anti-KV Channel Interacting Protein 2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, rabbit
western blot pricing
SAB1305056 ANTI-MOUSE KCHIP2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
ELISA pricing
SAB1304377 ANTI-MOUSE KCHIP2B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
WH0030819M1 Monoclonal Anti-KCNIP2 antibody produced in mouse clone 3E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5200071 Monoclonal Anti-KCNIP2 antibody produced in mouse clone S60-73, 1 mg/mL, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014591 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014591 Rosetta Predictions human pricing
NM_173191 Rosetta Predictions human pricing
NM_173192 Rosetta Predictions human pricing
NM_173193 Rosetta Predictions human pricing
NM_173194 Rosetta Predictions human pricing
NM_173195 Rosetta Predictions human pricing
NM_173197 Rosetta Predictions human pricing
NM_173342 Rosetta Predictions human pricing
NM_001033961 Rosetta Predictions rat pricing
NM_020094 Rosetta Predictions rat pricing
NM_020095 Rosetta Predictions rat pricing
NM_030716 Rosetta Predictions mouse pricing
NM_145703 Rosetta Predictions mouse pricing
NM_145704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085293 predicted 1281
2 SASI_Hs01_00085294 predicted 1117
3 SASI_Hs01_00085295 predicted 1680
4 SASI_Hs01_00085296 predicted 1597
5 SASI_Hs01_00085297 predicted 968
6 SASI_Hs01_00085298 predicted 1024
7 SASI_Hs01_00085299 predicted 1027
8 SASI_Hs01_00085300 predicted 1625
9 SASI_Hs01_00085301 predicted 978
10 SASI_Hs01_00085302 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164306 predicted 1233
2 SASI_Hs01_00164307 predicted 1067
3 SASI_Hs01_00164308 predicted 1635
4 SASI_Hs01_00164309 predicted 1556
5 SASI_Hs01_00164310 predicted 926
6 SASI_Hs01_00164311 predicted 979
7 SASI_Hs01_00164312 predicted 983
8 SASI_Hs01_00164313 predicted 1585
9 SASI_Hs01_00164314 predicted 925
10 SASI_Hs01_00164315 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027937 predicted 1182
2 SASI_Hs01_00027938 predicted 1020
3 SASI_Hs01_00027939 predicted 1577
4 SASI_Hs01_00027940 predicted 1500
5 SASI_Hs01_00027941 predicted 877
6 SASI_Hs01_00027942 predicted 921
7 SASI_Hs01_00027943 predicted 928
8 SASI_Hs01_00027944 predicted 1532
9 SASI_Hs01_00027945 predicted 873
10 SASI_Hs01_00027946 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096764 predicted 1106
2 SASI_Hs01_00096765 predicted 939
3 SASI_Hs01_00096766 predicted 1502
4 SASI_Hs01_00096767 predicted 1420
5 SASI_Hs01_00096768 predicted 803
6 SASI_Hs01_00096769 predicted 845
7 SASI_Hs01_00096770 predicted 854
8 SASI_Hs01_00096771 predicted 1450
9 SASI_Hs01_00096772 predicted 798
10 SASI_Hs01_00096773 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102135 predicted 760
2 SASI_Hs01_00102136 predicted 599
3 SASI_Hs01_00102137 predicted 1158
4 SASI_Hs01_00102138 predicted 1082
5 SASI_Hs01_00102139 predicted 458
6 SASI_Hs01_00102140 predicted 499
7 SASI_Hs01_00102141 predicted 513
8 SASI_Hs01_00102142 predicted 1106
9 SASI_Hs01_00102143 predicted 458
10 SASI_Hs01_00102144 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128381 predicted 1089
2 SASI_Hs01_00128382 predicted 924
3 SASI_Hs01_00128383 predicted 1485
4 SASI_Hs01_00128384 predicted 1397
5 SASI_Hs01_00128385 predicted 774
6 SASI_Hs01_00128386 predicted 826
7 SASI_Hs01_00128387 predicted 833
8 SASI_Hs01_00128388 predicted 1435
9 SASI_Hs01_00128389 predicted 781
10 SASI_Hs01_00128390 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062845 predicted 591
2 SASI_Hs01_00062846 predicted 660
3 SASI_Hs01_00062848 predicted 555
4 SASI_Hs01_00062849 predicted 664
5 SASI_Hs02_00368150 predicted 550
6 SASI_Hs01_00062851 predicted 564
7 SASI_Hs01_00062852 predicted 549
8 SASI_Hs01_00062853 predicted 554
9 SASI_Hs02_00368151 predicted 623
10 SASI_Hs01_00062854 predicted 565
11 SASI_Hs01_00062847 predicted 651
12 SASI_Hs01_00062850 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079010 predicted 1165
2 SASI_Hs01_00079011 predicted 979
3 SASI_Hs01_00079012 predicted 372
4 SASI_Hs01_00079013 predicted 1056
5 SASI_Hs01_00079014 predicted 1059
6 SASI_Hs01_00079015 predicted 1160
7 SASI_Hs01_00079016 predicted 762
8 SASI_Hs01_00079017 predicted 895
9 SASI_Hs01_00079018 predicted 982
10 SASI_Hs01_00079019 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038647 predicted 1158
2 SASI_Rn01_00038648 predicted 697
3 SASI_Rn01_00038649 predicted 603
4 SASI_Rn01_00038650 predicted 1063
5 SASI_Rn01_00038651 predicted 532
6 SASI_Rn01_00038652 predicted 1181
7 SASI_Rn01_00038653 predicted 657
8 SASI_Rn01_00038654 predicted 747
9 SASI_Rn01_00038656 predicted 614
10 SASI_Rn02_00203840 predicted 1233
11 SASI_Rn01_00038655 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107359 predicted 1311
2 SASI_Rn01_00107360 predicted 845
3 SASI_Rn01_00107361 predicted 751
4 SASI_Rn01_00107362 predicted 1209
5 SASI_Rn01_00107363 predicted 681
6 SASI_Rn01_00107364 predicted 1336
7 SASI_Rn01_00107365 predicted 815
8 SASI_Rn01_00107366 predicted 896
9 SASI_Rn01_00107368 predicted 768
10 SASI_Rn02_00262501 predicted 1380
11 SASI_Rn01_00107367 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060635 predicted 1250
2 SASI_Rn01_00060636 predicted 788
3 SASI_Rn01_00060637 predicted 702
4 SASI_Rn01_00060638 predicted 1155
5 SASI_Rn01_00060639 predicted 623
6 SASI_Rn01_00060640 predicted 1282
7 SASI_Rn01_00060641 predicted 755
8 SASI_Rn01_00060642 predicted 839
9 SASI_Rn01_00060644 predicted 706
10 SASI_Rn02_00262502 predicted 1326
11 SASI_Rn01_00060643 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157494 predicted 405
2 SASI_Mm01_00157495 predicted 431
3 SASI_Mm01_00157496 predicted 481
4 SASI_Mm01_00157497 predicted 387
5 SASI_Mm01_00157498 predicted 489
6 SASI_Mm01_00157499 predicted 493
7 SASI_Mm01_00157500 predicted 485
8 SASI_Mm01_00157501 predicted 428
9 SASI_Mm01_00157502 predicted 510
10 SASI_Mm01_00157503 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125719 predicted 463
2 SASI_Mm01_00125720 predicted 481
3 SASI_Mm01_00125721 predicted 537
4 SASI_Mm01_00125722 predicted 444
5 SASI_Mm01_00125723 predicted 535
6 SASI_Mm01_00125724 predicted 540
7 SASI_Mm01_00125725 predicted 539
8 SASI_Mm01_00125726 predicted 491
9 SASI_Mm01_00125727 predicted 571
10 SASI_Mm01_00125728 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043825 predicted 314
2 SASI_Mm01_00043826 predicted 336
3 SASI_Mm01_00043827 predicted 389
4 SASI_Mm01_00043828 predicted 295
5 SASI_Mm01_00043829 predicted 394
6 SASI_Mm01_00043830 predicted 396
7 SASI_Mm01_00043831 predicted 394
8 SASI_Mm01_00043832 predicted 341
9 SASI_Mm01_00043833 predicted 423
10 SASI_Mm01_00043834 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014591
KCNIP2 MISSION shRNA Bacterial Glycerol Stock
Kv channel interacting protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-552s21c1
Sequence:CCGGGTTCGCTCCCTTCAGCATTAGCTCGAGCTAATGCTGAAGGGAGCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-925s21c1
Sequence:CCGGTGTAGATGACAGGCTTAATTGCTCGAGCAATTAAGCCTGTCATCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-504s21c1
Sequence:CCGGTGCCCTCAGTCAGTGAAATTGCTCGAGCAATTTCACTGACTGAGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-894s21c1
Sequence:CCGGTGGCTGGTTTGTCCGTGATTCCTCGAGGAATCACGGACAAACCAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-763s1c1
Sequence:CCGGGCAGATTTACTCCCAGTTCTTCTCGAGAAGAACTGGGAGTAAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-603s1c1
Sequence:CCGGGCGTGGACGATGAATTTGAATCTCGAGATTCAAATTCATCGTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-736s1c1
Sequence:CCGGCGGAATTGTCAATGAGGAGAACTCGAGTTCTCCTCATTGACAATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-926s1c1
Sequence:CCGGGCCTTCAACCTGTATGACCTTCTCGAGAAGGTCATACAGGTTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-1168s1c1
Sequence:CCGGGCTCTTTGACAATGTCATCTACTCGAGTAGATGACATTGTCAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014591
KCNIP2 MISSION shRNA shRNA Plasmid DNA
Kv channel interacting protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-552s21c1
Sequence:CCGGGTTCGCTCCCTTCAGCATTAGCTCGAGCTAATGCTGAAGGGAGCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-925s21c1
Sequence:CCGGTGTAGATGACAGGCTTAATTGCTCGAGCAATTAAGCCTGTCATCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-504s21c1
Sequence:CCGGTGCCCTCAGTCAGTGAAATTGCTCGAGCAATTTCACTGACTGAGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-894s21c1
Sequence:CCGGTGGCTGGTTTGTCCGTGATTCCTCGAGGAATCACGGACAAACCAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-763s1c1
Sequence:CCGGGCAGATTTACTCCCAGTTCTTCTCGAGAAGAACTGGGAGTAAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-603s1c1
Sequence:CCGGGCGTGGACGATGAATTTGAATCTCGAGATTCAAATTCATCGTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-736s1c1
Sequence:CCGGCGGAATTGTCAATGAGGAGAACTCGAGTTCTCCTCATTGACAATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-926s1c1
Sequence:CCGGGCCTTCAACCTGTATGACCTTCTCGAGAAGGTCATACAGGTTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-1168s1c1
Sequence:CCGGGCTCTTTGACAATGTCATCTACTCGAGTAGATGACATTGTCAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014591
KCNIP2 MISSION shRNA Lentiviral Transduction Particles
Kv channel interacting protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-552s21c1
Sequence:CCGGGTTCGCTCCCTTCAGCATTAGCTCGAGCTAATGCTGAAGGGAGCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-925s21c1
Sequence:CCGGTGTAGATGACAGGCTTAATTGCTCGAGCAATTAAGCCTGTCATCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-504s21c1
Sequence:CCGGTGCCCTCAGTCAGTGAAATTGCTCGAGCAATTTCACTGACTGAGGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014591.4-894s21c1
Sequence:CCGGTGGCTGGTTTGTCCGTGATTCCTCGAGGAATCACGGACAAACCAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-763s1c1
Sequence:CCGGGCAGATTTACTCCCAGTTCTTCTCGAGAAGAACTGGGAGTAAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-603s1c1
Sequence:CCGGGCGTGGACGATGAATTTGAATCTCGAGATTCAAATTCATCGTCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-736s1c1
Sequence:CCGGCGGAATTGTCAATGAGGAGAACTCGAGTTCTCCTCATTGACAATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-926s1c1
Sequence:CCGGGCCTTCAACCTGTATGACCTTCTCGAGAAGGTCATACAGGTTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014591.3-1168s1c1
Sequence:CCGGGCTCTTTGACAATGTCATCTACTCGAGTAGATGACATTGTCAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030716
KCNIP2 MISSION shRNA Bacterial Glycerol Stock
Kv channel interacting protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-397s1c1
Sequence:CCGGGCCTTTGACACCAACCATGATCTCGAGATCATGGTTGGTGTCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-40s1c1
Sequence:CCGGCGAGATTTGGACGGCTCCTATCTCGAGATAGGAGCCGTCCAAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-445s1c1
Sequence:CCGGGCTGGTTTGTCAGTGATTCTTCTCGAGAAGAATCACTGACAAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-552s1c1
Sequence:CCGGCGACATCATGAAGTCCATCTACTCGAGTAGATGGACTTCATGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-318s1c1
Sequence:CCGGCGAGGAGAACTTCAAGCAAATCTCGAGATTTGCTTGAAGTTCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030716
KCNIP2 MISSION shRNA shRNA Plasmid DNA
Kv channel interacting protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-397s1c1
Sequence:CCGGGCCTTTGACACCAACCATGATCTCGAGATCATGGTTGGTGTCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-40s1c1
Sequence:CCGGCGAGATTTGGACGGCTCCTATCTCGAGATAGGAGCCGTCCAAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-445s1c1
Sequence:CCGGGCTGGTTTGTCAGTGATTCTTCTCGAGAAGAATCACTGACAAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-552s1c1
Sequence:CCGGCGACATCATGAAGTCCATCTACTCGAGTAGATGGACTTCATGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-318s1c1
Sequence:CCGGCGAGGAGAACTTCAAGCAAATCTCGAGATTTGCTTGAAGTTCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030716
KCNIP2 MISSION shRNA Lentiviral Transduction Particles
Kv channel interacting protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-397s1c1
Sequence:CCGGGCCTTTGACACCAACCATGATCTCGAGATCATGGTTGGTGTCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-40s1c1
Sequence:CCGGCGAGATTTGGACGGCTCCTATCTCGAGATAGGAGCCGTCCAAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-445s1c1
Sequence:CCGGGCTGGTTTGTCAGTGATTCTTCTCGAGAAGAATCACTGACAAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-552s1c1
Sequence:CCGGCGACATCATGAAGTCCATCTACTCGAGTAGATGGACTTCATGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030716.2-318s1c1
Sequence:CCGGCGAGGAGAACTTCAAGCAAATCTCGAGATTTGCTTGAAGTTCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)