EMAIL THIS PAGE TO A FRIEND

KCNIP3

Kv channel interacting protein 3, calsenilin

152 Gene Product Result for
Synonyms: CSEN DREAM KCHIP3
Gene ID:
Human(30818) Summary: This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins, which belong to the recoverin branch of the EF-hand superfamily. Members of this family are small calcium binding proteins containing EF-hand-like domains. They are integral subunit components of native Kv4 channel complexes that may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. The encoded protein also functions as a calcium-regulated transcriptional repressor, and interacts with presenilins. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(56461) Kv channel interacting protein 3, calsenilin
Rat(65199) Kv channel interacting protein 3, calsenilin
dog(609135) Kv channel interacting protein 3, calsenilin
domestic cat(101087056) Kv channel interacting protein 3, calsenilin
cow(513316) Kv channel interacting protein 3, calsenilin
sheep(101114598) Kv channel interacting protein 3, calsenilin
domestic guinea pig(100717101) Kv channel interacting protein 3, calsenilin
naked mole-rat(101699907) Kv channel interacting protein 3, calsenilin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31932 Anti-CSEN antibody produced in rabbit affinity isolated antibody bovine, horse, human, mouse, rat, guinea pig, pig, zebrafish, rabbit, canine
immunohistochemistry, western blot pricing
SAB1306583 ANTI-KCHIP3 (N-TERM M1) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2501981 Anti-KCNIP3 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, bovine, human
ELISA, western blot pricing
SAB2501980 Anti-KCNIP3 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, bovine, human
ELISA, western blot pricing
SAB1407407 Anti-KCNIP3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
western blot pricing
SAB4501389 Anti-KCNIP3 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2106271 Anti-KCNIP3 antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, mouse
western blot pricing
SAB1410623 Anti-KCNIP3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing
HPA069797 Anti-KCNIP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing
SAB4504220 Anti-phospho-Calsenilin/KCNIP3 (pSer63) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0030818M1 Monoclonal Anti-CSEN antibody produced in mouse clone 2B3-A1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1405064 Monoclonal Anti-CSEN antibody produced in mouse clone 2B3-A1, ascites fluid human
ELISA, western blot pricing
SAB5200073 Monoclonal Anti-KCNIP3 antibody produced in mouse clone S66-38, 1 mg/mL, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013434 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034914 Rosetta Predictions human pricing
NM_013434 Rosetta Predictions human pricing
NM_032462 Rosetta Predictions rat pricing
NM_001111331 Rosetta Predictions mouse pricing
NM_019789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076762 predicted 365
2 SASI_Hs01_00076764 predicted 430
3 SASI_Hs01_00076765 predicted 296
4 SASI_Hs02_00308153 predicted 353
5 SASI_Hs01_00076766 predicted 628
6 SASI_Hs01_00076768 predicted 1077
7 SASI_Hs01_00076769 predicted 1156
8 SASI_Hs01_00076770 predicted 969
9 SASI_Hs01_00076771 predicted 1150
10 SASI_Hs02_00308154 predicted 1050
11 SASI_Hs01_00076763 predicted 315
12 SASI_Hs01_00076767 predicted 92
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163285 predicted 557
2 SASI_Hs01_00163287 predicted 620
3 SASI_Hs01_00163288 predicted 488
4 SASI_Hs02_00344824 predicted 548
5 SASI_Hs01_00163289 predicted 181
6 SASI_Hs02_00344825 predicted 1274
7 SASI_Hs01_00163291 predicted 1347
8 SASI_Hs01_00163292 predicted 1338
9 SASI_Hs01_00163294 predicted 118
10 SASI_Hs02_00344826 predicted 1244
11 SASI_Hs01_00163286 predicted 510
12 SASI_Hs01_00163290 predicted 823
13 SASI_Hs01_00163293 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101795 predicted 343
2 SASI_Rn01_00101796 predicted 521
3 SASI_Rn01_00101797 predicted 347
4 SASI_Rn01_00101798 predicted 352
5 SASI_Rn01_00101799 predicted 366
6 SASI_Rn01_00101800 predicted 355
7 SASI_Rn01_00101801 predicted 561
8 SASI_Rn01_00101802 predicted 263
9 SASI_Rn01_00101803 predicted 208
10 SASI_Rn01_00101804 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306844 predicted 992
2 SASI_Mm02_00306845 predicted 760
3 SASI_Mm02_00306846 predicted 1500
4 SASI_Mm02_00306847 predicted 999
5 SASI_Mm02_00306848 predicted 696
6 SASI_Mm02_00306849 predicted 563
7 SASI_Mm02_00306850 predicted 641
8 SASI_Mm02_00306851 predicted 588
9 SASI_Mm02_00306852 predicted 1445
10 SASI_Mm02_00306853 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083748 predicted 559
2 SASI_Mm01_00083751 predicted 1301
3 SASI_Mm01_00083754 predicted 491
4 SASI_Mm02_00325002 predicted 666
5 SASI_Mm02_00325003 predicted 792
6 SASI_Mm01_00083745 predicted 360
7 SASI_Mm02_00325004 predicted 446
8 SASI_Mm01_00083749 predicted 393
9 SASI_Mm02_00325005 predicted 1250
10 SASI_Mm02_00325006 predicted 930
11 SASI_Mm01_00083746 predicted 305
12 SASI_Mm01_00083747 predicted 235
13 SASI_Mm01_00083750 predicted 246
14 SASI_Mm01_00083752 predicted 465
15 SASI_Mm01_00083753 predicted 1324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019789
KCNIP3 MISSION shRNA Bacterial Glycerol Stock
Kv channel interacting protein 3, calsenilin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019789.2-1985s1c1
Sequence:CCGGGCCAACATTCTAAAGCACAAACTCGAGTTTGTGCTTTAGAATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-241s1c1
Sequence:CCGGCCTGATGCGTTGCTGCTTAATCTCGAGATTAAGCAGCAACGCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-761s1c1
Sequence:CCGGGTGGAGAGGTTCTTTCAGAAACTCGAGTTTCTGAAAGAACCTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-451s1c1
Sequence:CCGGAGACACCTTCAAACTCATTTACTCGAGTAAATGAGTTTGAAGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-452s1c1
Sequence:CCGGGACACCTTCAAACTCATTTATCTCGAGATAAATGAGTTTGAAGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019789.3-621s21c1
Sequence:CCGGAGTGGGCCTTCAATCTCTATGCTCGAGCATAGAGATTGAAGGCCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019789.3-1234s21c1
Sequence:CCGGGAGAGGACCAGGTCTACAAAGCTCGAGCTTTGTAGACCTGGTCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019789.3-1152s21c1
Sequence:CCGGGCCTATTCCTAGGTCAATAAACTCGAGTTTATTGACCTAGGAATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019789.3-1305s21c1
Sequence:CCGGCCTATGGACCCATGCTCTTAGCTCGAGCTAAGAGCATGGGTCCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019789
KCNIP3 MISSION shRNA shRNA Plasmid DNA
Kv channel interacting protein 3, calsenilin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019789.2-1985s1c1
Sequence:CCGGGCCAACATTCTAAAGCACAAACTCGAGTTTGTGCTTTAGAATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-241s1c1
Sequence:CCGGCCTGATGCGTTGCTGCTTAATCTCGAGATTAAGCAGCAACGCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-761s1c1
Sequence:CCGGGTGGAGAGGTTCTTTCAGAAACTCGAGTTTCTGAAAGAACCTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-451s1c1
Sequence:CCGGAGACACCTTCAAACTCATTTACTCGAGTAAATGAGTTTGAAGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-452s1c1
Sequence:CCGGGACACCTTCAAACTCATTTATCTCGAGATAAATGAGTTTGAAGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019789.3-621s21c1
Sequence:CCGGAGTGGGCCTTCAATCTCTATGCTCGAGCATAGAGATTGAAGGCCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019789.3-1234s21c1
Sequence:CCGGGAGAGGACCAGGTCTACAAAGCTCGAGCTTTGTAGACCTGGTCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019789.3-1152s21c1
Sequence:CCGGGCCTATTCCTAGGTCAATAAACTCGAGTTTATTGACCTAGGAATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019789.3-1305s21c1
Sequence:CCGGCCTATGGACCCATGCTCTTAGCTCGAGCTAAGAGCATGGGTCCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019789
KCNIP3 MISSION shRNA Lentiviral Transduction Particles
Kv channel interacting protein 3, calsenilin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019789.2-1985s1c1
Sequence:CCGGGCCAACATTCTAAAGCACAAACTCGAGTTTGTGCTTTAGAATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-241s1c1
Sequence:CCGGCCTGATGCGTTGCTGCTTAATCTCGAGATTAAGCAGCAACGCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-761s1c1
Sequence:CCGGGTGGAGAGGTTCTTTCAGAAACTCGAGTTTCTGAAAGAACCTCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-451s1c1
Sequence:CCGGAGACACCTTCAAACTCATTTACTCGAGTAAATGAGTTTGAAGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019789.2-452s1c1
Sequence:CCGGGACACCTTCAAACTCATTTATCTCGAGATAAATGAGTTTGAAGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019789.3-621s21c1
Sequence:CCGGAGTGGGCCTTCAATCTCTATGCTCGAGCATAGAGATTGAAGGCCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019789.3-1234s21c1
Sequence:CCGGGAGAGGACCAGGTCTACAAAGCTCGAGCTTTGTAGACCTGGTCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019789.3-1152s21c1
Sequence:CCGGGCCTATTCCTAGGTCAATAAACTCGAGTTTATTGACCTAGGAATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019789.3-1305s21c1
Sequence:CCGGCCTATGGACCCATGCTCTTAGCTCGAGCTAAGAGCATGGGTCCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013434
KCNIP3 MISSION shRNA Bacterial Glycerol Stock
Kv channel interacting protein 3, calsenilin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-599s1c1
Sequence:CCGGGCCTTTAATCTCTACGACATTCTCGAGAATGTCGTAGAGATTAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-734s1c1
Sequence:CCGGGTGGAGAGGTTCTTCGAGAAACTCGAGTTTCTCGAAGAACCTCTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-387s1c1
Sequence:CCGGGCTTTAAGAATGAGTGTCCCACTCGAGTGGGACACTCATTCTTAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-160s1c1
Sequence:CCGGACTTAGCAAGAAGGAGGGTATCTCGAGATACCCTCCTTCTTGCTAAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-433s1c1
Sequence:CCGGCAAACTCATTTACGCGCAGTTCTCGAGAACTGCGCGTAAATGAGTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013434.4-826s21c1
Sequence:CCGGGGCCTGTCAGAAGGATGAGAACTCGAGTTCTCATCCTTCTGACAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013434
KCNIP3 MISSION shRNA shRNA Plasmid DNA
Kv channel interacting protein 3, calsenilin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-599s1c1
Sequence:CCGGGCCTTTAATCTCTACGACATTCTCGAGAATGTCGTAGAGATTAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-734s1c1
Sequence:CCGGGTGGAGAGGTTCTTCGAGAAACTCGAGTTTCTCGAAGAACCTCTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-387s1c1
Sequence:CCGGGCTTTAAGAATGAGTGTCCCACTCGAGTGGGACACTCATTCTTAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-160s1c1
Sequence:CCGGACTTAGCAAGAAGGAGGGTATCTCGAGATACCCTCCTTCTTGCTAAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-433s1c1
Sequence:CCGGCAAACTCATTTACGCGCAGTTCTCGAGAACTGCGCGTAAATGAGTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013434.4-826s21c1
Sequence:CCGGGGCCTGTCAGAAGGATGAGAACTCGAGTTCTCATCCTTCTGACAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013434
KCNIP3 MISSION shRNA Lentiviral Transduction Particles
Kv channel interacting protein 3, calsenilin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-599s1c1
Sequence:CCGGGCCTTTAATCTCTACGACATTCTCGAGAATGTCGTAGAGATTAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-734s1c1
Sequence:CCGGGTGGAGAGGTTCTTCGAGAAACTCGAGTTTCTCGAAGAACCTCTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-387s1c1
Sequence:CCGGGCTTTAAGAATGAGTGTCCCACTCGAGTGGGACACTCATTCTTAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-160s1c1
Sequence:CCGGACTTAGCAAGAAGGAGGGTATCTCGAGATACCCTCCTTCTTGCTAAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013434.3-433s1c1
Sequence:CCGGCAAACTCATTTACGCGCAGTTCTCGAGAACTGCGCGTAAATGAGTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013434.4-826s21c1
Sequence:CCGGGGCCTGTCAGAAGGATGAGAACTCGAGTTCTCATCCTTCTGACAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)