EMAIL THIS PAGE TO A FRIEND

KCNIP4

Kv channel interacting protein 4

163 Gene Product Result for
Synonyms: CALP KCHIP4
Gene ID:
Human(80333) Summary: This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. This protein member also interacts with presenilin. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(80334) Kv channel interacting protein 4
Rat(259243) Kv channel interacting protein 4
chicken(395239) Kv channel interacting protein 4
cow(614299) Kv channel interacting protein 4
domestic cat(101084537) Kv channel interacting protein 4
dog(479129) Kv channel interacting protein 4
naked mole-rat(101706355) Kv channel interacting protein 4
sheep(101101984) Kv channel interacting protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34622 Anti-KCNIP4 antibody produced in rabbit affinity isolated antibody rabbit, rat, bovine, canine, human, mouse
immunohistochemistry, western blot pricing
HPA022862 Anti-KCNIP4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunohistochemistry pricing
SAB2101214 Anti-KCNIP4 antibody produced in rabbit affinity isolated antibody rat, canine, bovine, rabbit, human, mouse
western blot pricing
C2687 Monoclonal Anti-Calponin antibody produced in mouse clone hCP, ascites fluid human, mouse, rabbit, pig, rat
immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
WH0080333M1 Monoclonal Anti-KCNIP4 antibody produced in mouse clone 1A11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030265 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030265 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030265 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063621 MISSION® esiRNA esiRNA human KCNIP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035003 Rosetta Predictions human pricing
NM_001035004 Rosetta Predictions human pricing
NM_025221 Rosetta Predictions human pricing
NM_147181 Rosetta Predictions human pricing
NM_147182 Rosetta Predictions human pricing
NM_147183 Rosetta Predictions human pricing
NM_181365 Rosetta Predictions rat pricing
NM_030265 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039341 predicted 556
2 SASI_Hs01_00039342 predicted 964
3 SASI_Hs01_00039343 predicted 1031
4 SASI_Hs01_00039344 predicted 715
5 SASI_Hs01_00039345 predicted 848
6 SASI_Hs01_00039346 predicted 1007
7 SASI_Hs01_00039347 predicted 723
8 SASI_Hs01_00039348 predicted 951
9 SASI_Hs01_00039349 predicted 604
10 SASI_Hs01_00039350 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197808 predicted 476
2 SASI_Hs01_00197809 predicted 886
3 SASI_Hs01_00197810 predicted 954
4 SASI_Hs01_00197811 predicted 638
5 SASI_Hs01_00197812 predicted 770
6 SASI_Hs01_00197813 predicted 935
7 SASI_Hs01_00197814 predicted 643
8 SASI_Hs01_00197815 predicted 866
9 SASI_Hs01_00197816 predicted 519
10 SASI_Hs01_00197817 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236091 predicted 501
2 SASI_Hs01_00236092 predicted 909
3 SASI_Hs01_00236093 predicted 967
4 SASI_Hs01_00236094 predicted 645
5 SASI_Hs01_00236095 predicted 786
6 SASI_Hs01_00236096 predicted 942
7 SASI_Hs01_00236097 predicted 656
8 SASI_Hs01_00236098 predicted 888
9 SASI_Hs01_00236099 predicted 536
10 SASI_Hs01_00236100 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154570 predicted 390
2 SASI_Hs01_00154571 predicted 799
3 SASI_Hs01_00154572 predicted 861
4 SASI_Hs01_00154573 predicted 551
5 SASI_Hs01_00154574 predicted 675
6 SASI_Hs01_00154575 predicted 842
7 SASI_Hs01_00154576 predicted 553
8 SASI_Hs01_00154577 predicted 780
9 SASI_Hs01_00154578 predicted 438
10 SASI_Hs01_00154579 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120402 predicted 510
2 SASI_Hs01_00120403 predicted 914
3 SASI_Hs01_00120404 predicted 972
4 SASI_Hs01_00120405 predicted 663
5 SASI_Hs01_00120406 predicted 787
6 SASI_Hs01_00120407 predicted 960
7 SASI_Hs01_00120408 predicted 665
8 SASI_Hs01_00120409 predicted 891
9 SASI_Hs01_00120410 predicted 546
10 SASI_Hs01_00120411 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086520 predicted 318
2 SASI_Hs01_00086521 predicted 721
3 SASI_Hs01_00086522 predicted 783
4 SASI_Hs01_00086523 predicted 465
5 SASI_Hs01_00086524 predicted 599
6 SASI_Hs01_00086525 predicted 766
7 SASI_Hs01_00086526 predicted 474
8 SASI_Hs01_00086527 predicted 702
9 SASI_Hs01_00086528 predicted 357
10 SASI_Hs01_00086529 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032380 predicted 798
2 SASI_Rn02_00269690 predicted 917
3 SASI_Rn01_00032381 predicted 700
4 SASI_Rn01_00032382 predicted 918
5 SASI_Rn01_00032383 predicted 908
6 SASI_Rn01_00032384 predicted 779
7 SASI_Rn01_00032385 predicted 1035
8 SASI_Rn01_00032386 predicted 648
9 SASI_Rn01_00032388 predicted 638
10 SASI_Rn02_00269691 predicted 635
11 SASI_Rn01_00032387 predicted 810
12 SASI_Rn01_00032389 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138530 predicted 446
2 SASI_Mm01_00138531 predicted 286
3 SASI_Mm01_00138533 predicted 880
4 SASI_Mm01_00138534 predicted 844
5 SASI_Mm01_00138535 predicted 874
6 SASI_Mm01_00138536 predicted 849
7 SASI_Mm01_00138537 predicted 447
8 SASI_Mm02_00336748 predicted 289
9 SASI_Mm01_00138532 predicted 692
10 SASI_Mm02_00336749 predicted 272
11 SASI_Mm01_00138538 predicted 463
12 SASI_Mm01_00138539 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025221
KCNIP4 MISSION shRNA Bacterial Glycerol Stock
Kv channel interacting protein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025221.5-535s21c1
Sequence:CCGGGCTGTGAGTTTCGAGGATTTCCTCGAGGAAATCCTCGAAACTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025221.5-865s21c1
Sequence:CCGGGTGATTTAACTTGTCAAATAGCTCGAGCTATTTGACAAGTTAAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025221.5-964s21c1
Sequence:CCGGAGCTTGACACTGAAGCATATTCTCGAGAATATGCTTCAGTGTCAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-263s1c1
Sequence:CCGGCGTCGTCTCCTGCTATTCAAACTCGAGTTTGAATAGCAGGAGACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-790s1c1
Sequence:CCGGGTTACCATAGATGAGTTCATTCTCGAGAATGAACTCATCTATGGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-734s1c1
Sequence:CCGGCCAGACAACACGTTGAAACATCTCGAGATGTTTCAACGTGTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-415s1c1
Sequence:CCGGCCCAGTGGTGTTGTTAATGAACTCGAGTTCATTAACAACACCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-384s1c1
Sequence:CCGGGATCCTTTACAGAGGATTTAACTCGAGTTAAATCCTCTGTAAAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025221
KCNIP4 MISSION shRNA shRNA Plasmid DNA
Kv channel interacting protein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025221.5-535s21c1
Sequence:CCGGGCTGTGAGTTTCGAGGATTTCCTCGAGGAAATCCTCGAAACTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025221.5-865s21c1
Sequence:CCGGGTGATTTAACTTGTCAAATAGCTCGAGCTATTTGACAAGTTAAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025221.5-964s21c1
Sequence:CCGGAGCTTGACACTGAAGCATATTCTCGAGAATATGCTTCAGTGTCAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-263s1c1
Sequence:CCGGCGTCGTCTCCTGCTATTCAAACTCGAGTTTGAATAGCAGGAGACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-790s1c1
Sequence:CCGGGTTACCATAGATGAGTTCATTCTCGAGAATGAACTCATCTATGGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-734s1c1
Sequence:CCGGCCAGACAACACGTTGAAACATCTCGAGATGTTTCAACGTGTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-415s1c1
Sequence:CCGGCCCAGTGGTGTTGTTAATGAACTCGAGTTCATTAACAACACCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-384s1c1
Sequence:CCGGGATCCTTTACAGAGGATTTAACTCGAGTTAAATCCTCTGTAAAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025221
KCNIP4 MISSION shRNA Lentiviral Transduction Particles
Kv channel interacting protein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025221.5-535s21c1
Sequence:CCGGGCTGTGAGTTTCGAGGATTTCCTCGAGGAAATCCTCGAAACTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025221.5-865s21c1
Sequence:CCGGGTGATTTAACTTGTCAAATAGCTCGAGCTATTTGACAAGTTAAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025221.5-964s21c1
Sequence:CCGGAGCTTGACACTGAAGCATATTCTCGAGAATATGCTTCAGTGTCAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-263s1c1
Sequence:CCGGCGTCGTCTCCTGCTATTCAAACTCGAGTTTGAATAGCAGGAGACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-790s1c1
Sequence:CCGGGTTACCATAGATGAGTTCATTCTCGAGAATGAACTCATCTATGGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-734s1c1
Sequence:CCGGCCAGACAACACGTTGAAACATCTCGAGATGTTTCAACGTGTTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-415s1c1
Sequence:CCGGCCCAGTGGTGTTGTTAATGAACTCGAGTTCATTAACAACACCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025221.4-384s1c1
Sequence:CCGGGATCCTTTACAGAGGATTTAACTCGAGTTAAATCCTCTGTAAAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030265
KCNIP4 MISSION shRNA Bacterial Glycerol Stock
Kv channel interacting protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-746s1c1
Sequence:CCGGGCTGGACATAATGAAAGCAATCTCGAGATTGCTTTCATTATGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-630s1c1
Sequence:CCGGGAGGATTTCATCAAAGGTCTTCTCGAGAAGACCTTTGATGAAATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-872s1c1
Sequence:CCGGCGTTACCATAGATGAGTTCATCTCGAGATGAACTCATCTATGGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-516s1c1
Sequence:CCGGGAAGAAACTTTCAAGGAGATTCTCGAGAATCTCCTTGAAAGTTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-437s1c1
Sequence:CCGGCCAGAGCAAATTCACCAAGAACTCGAGTTCTTGGTGAATTTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030265
KCNIP4 MISSION shRNA shRNA Plasmid DNA
Kv channel interacting protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-746s1c1
Sequence:CCGGGCTGGACATAATGAAAGCAATCTCGAGATTGCTTTCATTATGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-630s1c1
Sequence:CCGGGAGGATTTCATCAAAGGTCTTCTCGAGAAGACCTTTGATGAAATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-872s1c1
Sequence:CCGGCGTTACCATAGATGAGTTCATCTCGAGATGAACTCATCTATGGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-516s1c1
Sequence:CCGGGAAGAAACTTTCAAGGAGATTCTCGAGAATCTCCTTGAAAGTTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-437s1c1
Sequence:CCGGCCAGAGCAAATTCACCAAGAACTCGAGTTCTTGGTGAATTTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030265
KCNIP4 MISSION shRNA Lentiviral Transduction Particles
Kv channel interacting protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-746s1c1
Sequence:CCGGGCTGGACATAATGAAAGCAATCTCGAGATTGCTTTCATTATGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-630s1c1
Sequence:CCGGGAGGATTTCATCAAAGGTCTTCTCGAGAAGACCTTTGATGAAATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-872s1c1
Sequence:CCGGCGTTACCATAGATGAGTTCATCTCGAGATGAACTCATCTATGGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-516s1c1
Sequence:CCGGGAAGAAACTTTCAAGGAGATTCTCGAGAATCTCCTTGAAAGTTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030265.2-437s1c1
Sequence:CCGGCCAGAGCAAATTCACCAAGAACTCGAGTTCTTGGTGAATTTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)