EMAIL THIS PAGE TO A FRIEND

KCNJ10

potassium inwardly-rectifying channel, subfamily J, member 10

221 Gene Product Result for
Synonyms: BIRK-10 KCNJ13-PEN KIR1.2 KIR4.1 SESAME
UniProtKB ID: P78508, A3KME7, Q5VUT9, Q8N4I7, Q92808
Gene ID:
Human(3766) Summary: This gene encodes a member of the inward rectifier-type potassium channel family, characterized by having a greater tendency to allow potassium to flow into, rather than out of, a cell. The encoded protein may form a heterodimer with another potassium channel protein and may be responsible for the potassium buffering action of glial cells in the brain. Mutations in this gene have been associated with seizure susceptibility of common idiopathic generalized epilepsy syndromes. [provided by RefSeq, Jul 2008]
Mouse(16513) potassium inwardly-rectifying channel, subfamily J, member 10
Rat(29718) potassium inwardly-rectifying channel, subfamily J, member 10
domestic guinea pig(100728962) potassium inwardly-rectifying channel, subfamily J, member 10
naked mole-rat(101724136) potassium inwardly-rectifying channel, subfamily J, member 10
sheep(101117892) potassium inwardly-rectifying channel, subfamily J, member 10
Domestic Rabbit(100008597) potassium inwardly-rectifying channel, subfamily J, member 10
cow(533343) potassium inwardly-rectifying channel, subfamily J, member 10
Horse(100058121) potassium inwardly-rectifying channel, subfamily J, member 10
dog(488635) potassium inwardly-rectifying channel, subfamily J, member 10
domestic cat(101097297) potassium inwardly-rectifying channel, subfamily J, member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0003766M1 Monoclonal Anti-KCNJ10 antibody produced in mouse clone 1C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002241 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002241 Rosetta Predictions human pricing
NM_031602 Rosetta Predictions rat pricing
NM_001039484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333486 predicted 1255
2 SASI_Hs01_00032129 predicted 903
3 SASI_Hs01_00032130 predicted 847
4 SASI_Hs01_00032131 predicted 1351
5 SASI_Hs01_00032132 predicted 1107
6 SASI_Hs01_00032134 predicted 1041
7 SASI_Hs01_00032135 predicted 335
8 SASI_Hs01_00032136 predicted 1207
9 SASI_Hs01_00032137 predicted 384
10 SASI_Hs01_00032138 predicted 1115
11 SASI_Hs01_00032133 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117385 predicted 820
2 SASI_Rn01_00117386 predicted 1150
3 SASI_Rn01_00117387 predicted 880
4 SASI_Rn01_00117388 predicted 943
5 SASI_Rn01_00117389 predicted 1201
6 SASI_Rn01_00117390 predicted 621
7 SASI_Rn01_00117391 predicted 273
8 SASI_Rn01_00117392 predicted 1179
9 SASI_Rn01_00117393 predicted 331
10 SASI_Rn01_00117394 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048733 predicted 818
2 SASI_Mm01_00048734 predicted 999
3 SASI_Mm02_00290071 predicted 997
4 SASI_Mm01_00048736 predicted 946
5 SASI_Mm01_00048737 predicted 1439
6 SASI_Mm01_00048738 predicted 1320
7 SASI_Mm01_00048739 predicted 331
8 SASI_Mm01_00048740 predicted 395
9 SASI_Mm01_00048741 predicted 1169
10 SASI_Mm01_00048742 predicted 1301
11 SASI_Mm01_00048735 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002241
KCNJ10 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 10
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002241.3-1098s21c1
Sequence:CCGGACTGTCAGCCAGTGGTAAATACTCGAGTATTTACCACTGGCTGACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-1017s1c1
Sequence:CCGGCCCTTGAAAGATCTCCCTCTTCTCGAGAAGAGGGAGATCTTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-338s1c1
Sequence:CCGGCAACGTGAGAATGGAGCACATCTCGAGATGTGCTCCATTCTCACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-924s1c1
Sequence:CCGGCAGGTCAATGTGACTTTCCAACTCGAGTTGGAAAGTCACATTGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-256s1c1
Sequence:CCGGGTCAGACCACTCAGACAGAAACTCGAGTTTCTGTCTGAGTGGTCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-1299s1c1
Sequence:CCGGGAGGAGTCATTAAGGGAGCAACTCGAGTTGCTCCCTTAATGACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002241
KCNJ10 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 10
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002241.3-1098s21c1
Sequence:CCGGACTGTCAGCCAGTGGTAAATACTCGAGTATTTACCACTGGCTGACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-1017s1c1
Sequence:CCGGCCCTTGAAAGATCTCCCTCTTCTCGAGAAGAGGGAGATCTTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-338s1c1
Sequence:CCGGCAACGTGAGAATGGAGCACATCTCGAGATGTGCTCCATTCTCACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-924s1c1
Sequence:CCGGCAGGTCAATGTGACTTTCCAACTCGAGTTGGAAAGTCACATTGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-256s1c1
Sequence:CCGGGTCAGACCACTCAGACAGAAACTCGAGTTTCTGTCTGAGTGGTCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-1299s1c1
Sequence:CCGGGAGGAGTCATTAAGGGAGCAACTCGAGTTGCTCCCTTAATGACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002241
KCNJ10 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 10
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002241.3-1098s21c1
Sequence:CCGGACTGTCAGCCAGTGGTAAATACTCGAGTATTTACCACTGGCTGACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-1017s1c1
Sequence:CCGGCCCTTGAAAGATCTCCCTCTTCTCGAGAAGAGGGAGATCTTTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-338s1c1
Sequence:CCGGCAACGTGAGAATGGAGCACATCTCGAGATGTGCTCCATTCTCACGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-924s1c1
Sequence:CCGGCAGGTCAATGTGACTTTCCAACTCGAGTTGGAAAGTCACATTGACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-256s1c1
Sequence:CCGGGTCAGACCACTCAGACAGAAACTCGAGTTTCTGTCTGAGTGGTCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002241.2-1299s1c1
Sequence:CCGGGAGGAGTCATTAAGGGAGCAACTCGAGTTGCTCCCTTAATGACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020269
KCNJ10 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-221s1c1
Sequence:CCGGCGACCTTCATTGACATGCAATCTCGAGATTGCATGTCAATGAAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-715s1c1
Sequence:CCGGCAGACAAAGGAGGGTGAGAATCTCGAGATTCTCACCCTCCTTTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-193s1c1
Sequence:CCGGCGTTTCCTCTACCTCAAGGATCTCGAGATCCTTGAGGTAGAGGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-1113s1c1
Sequence:CCGGGCTCAAGTTGGAGGAGTCATTCTCGAGAATGACTCCTCCAACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-1013s1c1
Sequence:CCGGGCAAATACATAGCTGACTTCACTCGAGTGAAGTCAGCTATGTATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020269
KCNJ10 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-221s1c1
Sequence:CCGGCGACCTTCATTGACATGCAATCTCGAGATTGCATGTCAATGAAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-715s1c1
Sequence:CCGGCAGACAAAGGAGGGTGAGAATCTCGAGATTCTCACCCTCCTTTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-193s1c1
Sequence:CCGGCGTTTCCTCTACCTCAAGGATCTCGAGATCCTTGAGGTAGAGGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-1113s1c1
Sequence:CCGGGCTCAAGTTGGAGGAGTCATTCTCGAGAATGACTCCTCCAACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-1013s1c1
Sequence:CCGGGCAAATACATAGCTGACTTCACTCGAGTGAAGTCAGCTATGTATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020269
KCNJ10 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-221s1c1
Sequence:CCGGCGACCTTCATTGACATGCAATCTCGAGATTGCATGTCAATGAAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-715s1c1
Sequence:CCGGCAGACAAAGGAGGGTGAGAATCTCGAGATTCTCACCCTCCTTTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-193s1c1
Sequence:CCGGCGTTTCCTCTACCTCAAGGATCTCGAGATCCTTGAGGTAGAGGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-1113s1c1
Sequence:CCGGGCTCAAGTTGGAGGAGTCATTCTCGAGAATGACTCCTCCAACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020269.3-1013s1c1
Sequence:CCGGGCAAATACATAGCTGACTTCACTCGAGTGAAGTCAGCTATGTATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)