EMAIL THIS PAGE TO A FRIEND

KCNJ11

potassium inwardly-rectifying channel, subfamily J, member 11

128 Gene Product Result for
Synonyms: BIR HHF2 IKATP KIR6.2 PHHI TNDM3
UniProtKB ID: Q14654, B4DWI4, E9PNK0, Q2M1H7, Q58EX3, Q8IW96
Gene ID:
Human(3767) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and is found associated with the sulfonylurea receptor SUR. Mutations in this gene are a cause of familial persistent hyperinsulinemic hypoglycemia of infancy (PHHI), an autosomal recessive disorder characterized by unregulated insulin secretion. Defects in this gene may also contribute to autosomal dominant non-insulin-dependent diabetes mellitus type II (NIDDM), transient neonatal diabetes mellitus type 3 (TNDM3), and permanent neonatal diabetes mellitus (PNDM). Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2009]
Mouse(16514) potassium inwardly rectifying channel, subfamily J, member 11
Rat(83535) potassium inwardly rectifying channel, subfamily J, member 11
Zebrafish(664687) potassium inwardly-rectifying channel, subfamily J, member 11
Horse(100056520) potassium inwardly-rectifying channel, subfamily J, member 11
domestic cat(101097019) potassium inwardly-rectifying channel, subfamily J, member 11
chicken(428846) potassium inwardly-rectifying channel, subfamily J, member 11
cow(532060) potassium inwardly-rectifying channel, subfamily J, member 11
dog(485401) potassium inwardly-rectifying channel, subfamily J, member 11
sheep(101114135) potassium inwardly-rectifying channel, subfamily J, member 11
Domestic Rabbit(100008648) potassium inwardly-rectifying channel, subfamily J, member 11
domestic guinea pig(100135564) potassium inwardly rectifying channel, subfamily J, member 11
naked mole-rat(101705172) potassium inwardly-rectifying channel, subfamily J, member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
D9035 Diazoxide human, mouse, rat pricing
G0639 Glybenclamide ≥99% (HPLC) human, rat pricing
G2539 Glyburide meets USP testing specifications human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
P154 Pinacidil monohydrate powder mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000525 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035241 MISSION® esiRNA esiRNA human KCNJ11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000525 Rosetta Predictions human pricing
NM_031358 Rosetta Predictions rat pricing
NM_010602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220256 predicted 1530
2 SASI_Hs01_00220257 predicted 753
3 SASI_Hs02_00302725 predicted 755
4 SASI_Hs01_00220258 predicted 1521
5 SASI_Hs01_00220260 predicted 1500
6 SASI_Hs01_00220261 predicted 1843
7 SASI_Hs01_00220262 predicted 1555
8 SASI_Hs01_00220264 predicted 686
9 SASI_Hs02_00302726 predicted 1330
10 SASI_Hs01_00220265 predicted 1899
11 SASI_Hs01_00220259 predicted 778
12 SASI_Hs01_00220263 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100341 predicted 1144
2 SASI_Rn01_00100342 predicted 688
3 SASI_Rn01_00100343 predicted 1814
4 SASI_Rn01_00100344 predicted 701
5 SASI_Rn01_00100345 predicted 1451
6 SASI_Rn01_00100346 predicted 1667
7 SASI_Rn01_00100347 predicted 1101
8 SASI_Rn01_00100348 predicted 1571
9 SASI_Rn01_00100350 predicted 1207
10 SASI_Rn02_00264618 predicted 1236
11 SASI_Rn01_00100349 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094542 predicted 1246
2 SASI_Mm01_00094543 predicted 1323
3 SASI_Mm01_00094544 predicted 1331
4 SASI_Mm01_00094545 predicted 1188
5 SASI_Mm01_00094546 predicted 531
6 SASI_Mm01_00094547 predicted 1556
7 SASI_Mm01_00094548 predicted 1805
8 SASI_Mm01_00094549 predicted 1490
9 SASI_Mm01_00094550 predicted 1307
10 SASI_Mm01_00094551 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010602
KCNJ11 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010602.2-1857s1c1
Sequence:CCGGCCATGATTCATCTTGCCACAACTCGAGTTGTGGCAAGATGAATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-808s1c1
Sequence:CCGGGCTGATGATCAACGCCATCATCTCGAGATGATGGCGTTGATCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-868s1c1
Sequence:CCGGGCGGGCAGAAACCCTCATCTTCTCGAGAAGATGAGGGTTTCTGCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-1478s1c1
Sequence:CCGGCCCAAGTTTAGCATCTCTCCACTCGAGTGGAGAGATGCTAAACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-952s1c1
Sequence:CCGGCCTCCGAAAGAGCATGATCATCTCGAGATGATCATGCTCTTTCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010602.2-1712s21c1
Sequence:CCGGGGAGCCTGTACCGGGTTATTTCTCGAGAAATAACCCGGTACAGGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010602.2-1333s21c1
Sequence:CCGGCAAATTTGGTAACACCATTAACTCGAGTTAATGGTGTTACCAAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010602
KCNJ11 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010602.2-1857s1c1
Sequence:CCGGCCATGATTCATCTTGCCACAACTCGAGTTGTGGCAAGATGAATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-808s1c1
Sequence:CCGGGCTGATGATCAACGCCATCATCTCGAGATGATGGCGTTGATCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-868s1c1
Sequence:CCGGGCGGGCAGAAACCCTCATCTTCTCGAGAAGATGAGGGTTTCTGCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-1478s1c1
Sequence:CCGGCCCAAGTTTAGCATCTCTCCACTCGAGTGGAGAGATGCTAAACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-952s1c1
Sequence:CCGGCCTCCGAAAGAGCATGATCATCTCGAGATGATCATGCTCTTTCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010602.2-1712s21c1
Sequence:CCGGGGAGCCTGTACCGGGTTATTTCTCGAGAAATAACCCGGTACAGGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010602.2-1333s21c1
Sequence:CCGGCAAATTTGGTAACACCATTAACTCGAGTTAATGGTGTTACCAAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010602
KCNJ11 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010602.2-1857s1c1
Sequence:CCGGCCATGATTCATCTTGCCACAACTCGAGTTGTGGCAAGATGAATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-808s1c1
Sequence:CCGGGCTGATGATCAACGCCATCATCTCGAGATGATGGCGTTGATCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-868s1c1
Sequence:CCGGGCGGGCAGAAACCCTCATCTTCTCGAGAAGATGAGGGTTTCTGCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-1478s1c1
Sequence:CCGGCCCAAGTTTAGCATCTCTCCACTCGAGTGGAGAGATGCTAAACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010602.2-952s1c1
Sequence:CCGGCCTCCGAAAGAGCATGATCATCTCGAGATGATCATGCTCTTTCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010602.2-1712s21c1
Sequence:CCGGGGAGCCTGTACCGGGTTATTTCTCGAGAAATAACCCGGTACAGGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010602.2-1333s21c1
Sequence:CCGGCAAATTTGGTAACACCATTAACTCGAGTTAATGGTGTTACCAAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000525
KCNJ11 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-739s1c1
Sequence:CCGGGCTCATCTTCACCATGTCCTTCTCGAGAAGGACATGGTGAAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-620s1c1
Sequence:CCGGGCCCGCTTTGTGTCCAAGAAACTCGAGTTTCTTGGACACAAAGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-1492s1c1
Sequence:CCGGCGGACGTTACTCTGTGGACTACTCGAGTAGTCCACAGAGTAACGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-1012s1c1
Sequence:CCGGGCTTGGCTGCATCTTCATGAACTCGAGTTCATGAAGATGCAGCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-727s1c1
Sequence:CCGGGCCACACACATTGCTCATCTTCTCGAGAAGATGAGCAATGTGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000525.3-1332s21c1
Sequence:CCGGTGATCATCTACCATGTCATTGCTCGAGCAATGACATGGTAGATGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000525.3-1563s21c1
Sequence:CCGGAGTTTGGCAACACCGTCAAAGCTCGAGCTTTGACGGTGTTGCCAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000525
KCNJ11 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-739s1c1
Sequence:CCGGGCTCATCTTCACCATGTCCTTCTCGAGAAGGACATGGTGAAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-620s1c1
Sequence:CCGGGCCCGCTTTGTGTCCAAGAAACTCGAGTTTCTTGGACACAAAGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-1492s1c1
Sequence:CCGGCGGACGTTACTCTGTGGACTACTCGAGTAGTCCACAGAGTAACGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-1012s1c1
Sequence:CCGGGCTTGGCTGCATCTTCATGAACTCGAGTTCATGAAGATGCAGCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-727s1c1
Sequence:CCGGGCCACACACATTGCTCATCTTCTCGAGAAGATGAGCAATGTGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000525.3-1332s21c1
Sequence:CCGGTGATCATCTACCATGTCATTGCTCGAGCAATGACATGGTAGATGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000525.3-1563s21c1
Sequence:CCGGAGTTTGGCAACACCGTCAAAGCTCGAGCTTTGACGGTGTTGCCAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000525
KCNJ11 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-739s1c1
Sequence:CCGGGCTCATCTTCACCATGTCCTTCTCGAGAAGGACATGGTGAAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-620s1c1
Sequence:CCGGGCCCGCTTTGTGTCCAAGAAACTCGAGTTTCTTGGACACAAAGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-1492s1c1
Sequence:CCGGCGGACGTTACTCTGTGGACTACTCGAGTAGTCCACAGAGTAACGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-1012s1c1
Sequence:CCGGGCTTGGCTGCATCTTCATGAACTCGAGTTCATGAAGATGCAGCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000525.2-727s1c1
Sequence:CCGGGCCACACACATTGCTCATCTTCTCGAGAAGATGAGCAATGTGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000525.3-1332s21c1
Sequence:CCGGTGATCATCTACCATGTCATTGCTCGAGCAATGACATGGTAGATGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000525.3-1563s21c1
Sequence:CCGGAGTTTGGCAACACCGTCAAAGCTCGAGCTTTGACGGTGTTGCCAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)