EMAIL THIS PAGE TO A FRIEND

KCNJ12

potassium inwardly-rectifying channel, subfamily J, member 12

94 Gene Product Result for
Synonyms: IRK-2 IRK2 KCNJN1 Kir2.2 Kir2.2v hIRK hIRK1 hkir2.2x kcnj12x
UniProtKB ID: Q14500, O43401, Q15756, Q8NG63
Gene ID:
Human(3768) Summary: This gene encodes an inwardly rectifying K+ channel which may be blocked by divalent cations. This protein is thought to be one of multiple inwardly rectifying channels which contribute to the cardiac inward rectifier current (IK1). The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(16515) potassium inwardly-rectifying channel, subfamily J, member 12
Rat(117052) potassium inwardly-rectifying channel, subfamily J, member 12
chicken(427662) potassium inwardly-rectifying channel, subfamily J, member 12
cow(538479) potassium inwardly-rectifying channel, subfamily J, member 12
domestic cat(101082529) potassium inwardly-rectifying channel, subfamily J, member 12
dog(403760) potassium inwardly-rectifying channel, subfamily J, member 12
domestic guinea pig(100169698) potassium inwardly-rectifying channel, subfamily J, member 12
naked mole-rat(101718676) potassium inwardly-rectifying channel, subfamily J, member 12
sheep(101123388) potassium inwardly-rectifying channel, subfamily J, member 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018761 MISSION® esiRNA esiRNA targeting human KCNJ12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021012 Rosetta Predictions human pricing
NM_053981 Rosetta Predictions rat pricing
NM_010603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016137 predicted 1726
2 SASI_Hs01_00016139 predicted 1989
3 SASI_Hs01_00016140 predicted 1922
4 SASI_Hs01_00016141 predicted 859
5 SASI_Hs01_00016142 predicted 2206
6 SASI_Hs01_00016143 predicted 1769
7 SASI_Hs01_00016144 predicted 1328
8 SASI_Hs02_00354484 predicted 771
9 SASI_Hs01_00016145 predicted 1508
10 SASI_Hs01_00016146 predicted 1816
11 SASI_Hs01_00016138 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121316 predicted 1020
2 SASI_Rn01_00121318 predicted 497
3 SASI_Rn01_00121319 predicted 1103
4 SASI_Rn01_00121320 predicted 1263
5 SASI_Rn01_00121321 predicted 1336
6 SASI_Rn01_00121322 predicted 567
7 SASI_Rn01_00121324 predicted 1352
8 SASI_Rn02_00266976 predicted 551
9 SASI_Rn02_00266977 predicted 1325
10 SASI_Rn02_00266978 predicted 489
11 SASI_Rn01_00121315 predicted 788
12 SASI_Rn01_00121317 predicted 1432
13 SASI_Rn01_00121323 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144304 predicted 1201
2 SASI_Mm01_00144305 predicted 758
3 SASI_Mm01_00144306 predicted 1754
4 SASI_Mm01_00144307 predicted 1447
5 SASI_Mm01_00144308 predicted 1319
6 SASI_Mm01_00144309 predicted 1515
7 SASI_Mm01_00144310 predicted 685
8 SASI_Mm01_00144311 predicted 752
9 SASI_Mm01_00144312 predicted 1357
10 SASI_Mm01_00144313 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021012
KCNJ12 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021012.4-2148s21c1
Sequence:CCGGTGCAACGGCCTCAGAAGTTTGCTCGAGCAAACTTCTGAGGCCGTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021012.4-1455s21c1
Sequence:CCGCCATCGATGTGGGCTTCGACAACTCGAGTTGTCGAAGCCCACATCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021012.4-1217s21c1
Sequence:CCGGTCATCGACTCCTTCATGATTGCTCGAGCAATCATGAAGGAGTCGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021012.4-1508s21c1
Sequence:CCGGTCACCATCTTGCATGAGATTGCTCGAGCAATCTCATGCAAGATGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-1162s1c1
Sequence:CCGGCAACTCCTTCTGCTACGAGAACTCGAGTTCTCGTAGCAGAAGGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-205s1c1
Sequence:CCGGCAACATTGAGTTCGCCAACATCTCGAGATGTTGGCGAACTCAATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-1073s1c1
Sequence:CCGGTCGCACTTCCACAAGACCTATCTCGAGATAGGTCTTGTGGAAGTGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-286s1c1
Sequence:CCGGGCGGTACATGCTGCTCATCTTCTCGAGAAGATGAGCAGCATGTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-1051s1c1
Sequence:CCGGGAACCAGTACAAGATTGACTACTCGAGTAGTCAATCTTGTACTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021012
KCNJ12 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021012.4-2148s21c1
Sequence:CCGGTGCAACGGCCTCAGAAGTTTGCTCGAGCAAACTTCTGAGGCCGTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021012.4-1455s21c1
Sequence:CCGCCATCGATGTGGGCTTCGACAACTCGAGTTGTCGAAGCCCACATCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021012.4-1217s21c1
Sequence:CCGGTCATCGACTCCTTCATGATTGCTCGAGCAATCATGAAGGAGTCGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021012.4-1508s21c1
Sequence:CCGGTCACCATCTTGCATGAGATTGCTCGAGCAATCTCATGCAAGATGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-1162s1c1
Sequence:CCGGCAACTCCTTCTGCTACGAGAACTCGAGTTCTCGTAGCAGAAGGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-205s1c1
Sequence:CCGGCAACATTGAGTTCGCCAACATCTCGAGATGTTGGCGAACTCAATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-1073s1c1
Sequence:CCGGTCGCACTTCCACAAGACCTATCTCGAGATAGGTCTTGTGGAAGTGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-286s1c1
Sequence:CCGGGCGGTACATGCTGCTCATCTTCTCGAGAAGATGAGCAGCATGTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-1051s1c1
Sequence:CCGGGAACCAGTACAAGATTGACTACTCGAGTAGTCAATCTTGTACTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021012
KCNJ12 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021012.4-2148s21c1
Sequence:CCGGTGCAACGGCCTCAGAAGTTTGCTCGAGCAAACTTCTGAGGCCGTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021012.4-1455s21c1
Sequence:CCGCCATCGATGTGGGCTTCGACAACTCGAGTTGTCGAAGCCCACATCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021012.4-1217s21c1
Sequence:CCGGTCATCGACTCCTTCATGATTGCTCGAGCAATCATGAAGGAGTCGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021012.4-1508s21c1
Sequence:CCGGTCACCATCTTGCATGAGATTGCTCGAGCAATCTCATGCAAGATGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-1162s1c1
Sequence:CCGGCAACTCCTTCTGCTACGAGAACTCGAGTTCTCGTAGCAGAAGGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-205s1c1
Sequence:CCGGCAACATTGAGTTCGCCAACATCTCGAGATGTTGGCGAACTCAATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-1073s1c1
Sequence:CCGGTCGCACTTCCACAAGACCTATCTCGAGATAGGTCTTGTGGAAGTGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-286s1c1
Sequence:CCGGGCGGTACATGCTGCTCATCTTCTCGAGAAGATGAGCAGCATGTACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021012.3-1051s1c1
Sequence:CCGGGAACCAGTACAAGATTGACTACTCGAGTAGTCAATCTTGTACTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010603
KCNJ12 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010603.3-2145s1c1
Sequence:CCGGGCAAGACTGTTTACAAACAAACTCGAGTTTGTTTGTAAACAGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-1632s1c1
Sequence:CCGGCAACTCTTTCTGCTATGAGAACTCGAGTTCTCATAGCAGAAAGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-798s1c1
Sequence:CCGGCTGGTTGTTGTTTGGCATCATCTCGAGATGATGCCAAACAACAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-1512s1c1
Sequence:CCGGCGAAGAGAAGAACCAGTACAACTCGAGTTGTACTGGTTCTTCTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-666s1c1
Sequence:CCGGCGGTCAGTGCAACATTGAATTCTCGAGAATTCAATGTTGCACTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010603
KCNJ12 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010603.3-2145s1c1
Sequence:CCGGGCAAGACTGTTTACAAACAAACTCGAGTTTGTTTGTAAACAGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-1632s1c1
Sequence:CCGGCAACTCTTTCTGCTATGAGAACTCGAGTTCTCATAGCAGAAAGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-798s1c1
Sequence:CCGGCTGGTTGTTGTTTGGCATCATCTCGAGATGATGCCAAACAACAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-1512s1c1
Sequence:CCGGCGAAGAGAAGAACCAGTACAACTCGAGTTGTACTGGTTCTTCTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-666s1c1
Sequence:CCGGCGGTCAGTGCAACATTGAATTCTCGAGAATTCAATGTTGCACTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010603
KCNJ12 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010603.3-2145s1c1
Sequence:CCGGGCAAGACTGTTTACAAACAAACTCGAGTTTGTTTGTAAACAGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-1632s1c1
Sequence:CCGGCAACTCTTTCTGCTATGAGAACTCGAGTTCTCATAGCAGAAAGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-798s1c1
Sequence:CCGGCTGGTTGTTGTTTGGCATCATCTCGAGATGATGCCAAACAACAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-1512s1c1
Sequence:CCGGCGAAGAGAAGAACCAGTACAACTCGAGTTGTACTGGTTCTTCTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010603.3-666s1c1
Sequence:CCGGCGGTCAGTGCAACATTGAATTCTCGAGAATTCAATGTTGCACTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)