EMAIL THIS PAGE TO A FRIEND

KCNJ14

potassium inwardly-rectifying channel, subfamily J, member 14

166 Gene Product Result for
Synonyms: IRK4 KIR2.4
UniProtKB ID: Q9UNX9
Gene ID:
Human(3770) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel, and probably has a role in controlling the excitability of motor neurons. [provided by RefSeq, Feb 2013]
Mouse(211480) potassium inwardly-rectifying channel, subfamily J, member 14
Rat(276720) potassium inwardly-rectifying channel, subfamily J, member 14
Zebrafish(100526806) potassium inwardly-rectifying channel, subfamily J, member 14
cow(540740) potassium inwardly-rectifying channel, subfamily J, member 14
domestic cat(101095297) potassium inwardly-rectifying channel, subfamily J, member 14
dog(612053) potassium inwardly-rectifying channel, subfamily J, member 14
domestic guinea pig(100379252) potassium inwardly-rectifying channel, subfamily J, member 14
naked mole-rat(101726008) potassium inwardly-rectifying channel, subfamily J, member 14
sheep(101106197) potassium inwardly-rectifying channel, subfamily J, member 14
Domestic Rabbit(100348877) potassium inwardly-rectifying channel, subfamily J, member 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA071765 Anti-KCNJ14 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013348 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013348 Rosetta Predictions human pricing
NM_170720 Rosetta Predictions human pricing
NM_170718 Rosetta Predictions rat pricing
NM_145963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048491 predicted 570
2 SASI_Hs01_00048492 predicted 1485
3 SASI_Hs01_00048493 predicted 1351
4 SASI_Hs01_00048494 predicted 1340
5 SASI_Hs01_00048495 predicted 1418
6 SASI_Hs01_00048496 predicted 984
7 SASI_Hs01_00048498 predicted 1247
8 SASI_Hs01_00048499 predicted 1289
9 SASI_Hs02_00344662 predicted 931
10 SASI_Hs02_00344663 predicted 1823
11 SASI_Hs01_00048490 predicted 2000
12 SASI_Hs01_00048497 predicted 1897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203922 predicted 646
2 SASI_Hs01_00203923 predicted 1555
3 SASI_Hs01_00203924 predicted 1423
4 SASI_Hs01_00203925 predicted 1415
5 SASI_Hs01_00203926 predicted 1493
6 SASI_Hs01_00203927 predicted 1055
7 SASI_Hs01_00203929 predicted 1318
8 SASI_Hs01_00203930 predicted 1361
9 SASI_Hs02_00367676 predicted 1000
10 SASI_Hs02_00367677 predicted 1898
11 SASI_Hs01_00203921 predicted 2071
12 SASI_Hs01_00203928 predicted 1966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269055 predicted 2218
2 SASI_Rn02_00269056 predicted 1107
3 SASI_Rn02_00269057 predicted 2238
4 SASI_Rn02_00269058 predicted 1389
5 SASI_Rn02_00269059 predicted 2319
6 SASI_Rn02_00269060 predicted 2212
7 SASI_Rn02_00269061 predicted 1572
8 SASI_Rn02_00269062 predicted 2103
9 SASI_Rn02_00269063 predicted 2062
10 SASI_Rn02_00269064 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341438 predicted 728
2 SASI_Mm01_00097045 predicted 1911
3 SASI_Mm01_00097047 predicted 1003
4 SASI_Mm01_00097052 predicted 354
5 SASI_Mm02_00341439 predicted 1062
6 SASI_Mm02_00341440 predicted 1129
7 SASI_Mm02_00341441 predicted 1842
8 SASI_Mm02_00341442 predicted 1078
9 SASI_Mm02_00341443 predicted 1192
10 SASI_Mm02_00341444 predicted 990
11 SASI_Mm01_00097046 predicted 1724
12 SASI_Mm01_00097048 predicted 1835
13 SASI_Mm01_00097049 predicted 1925
14 SASI_Mm01_00097050 predicted 1848
15 SASI_Mm01_00097051 predicted 1825
16 SASI_Mm01_00097053 predicted 1809
17 SASI_Mm01_00097054 predicted 1608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145963
KCNJ14 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 14
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145963.2-1769s21c1
Sequence:CCGGGGTTGAACATCAGTGAGATACCTCGAGGTATCTCACTGATGTTCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-1218s1c1
Sequence:CCGGCGCCACTTCCATCGAACATATCTCGAGATATGTTCGATGGAAGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-1301s1c1
Sequence:CCGGCCACAGCCCTAAGTCAAGTTTCTCGAGAAACTTGACTTAGGGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145963.1-1628s1c1
Sequence:CCGGCCACAGATAGACCACACCTTTCTCGAGAAAGGTGTGGTCTATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-228s1c1
Sequence:CCGGGAGCCAGGAAACAGTCGAGCTCTCGAGAGCTCGACTGTTTCCTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-935s1c1
Sequence:CCGGCCAGGATGTAGATGTTGGTTTCTCGAGAAACCAACATCTACATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145963
KCNJ14 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 14
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145963.2-1769s21c1
Sequence:CCGGGGTTGAACATCAGTGAGATACCTCGAGGTATCTCACTGATGTTCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-1218s1c1
Sequence:CCGGCGCCACTTCCATCGAACATATCTCGAGATATGTTCGATGGAAGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-1301s1c1
Sequence:CCGGCCACAGCCCTAAGTCAAGTTTCTCGAGAAACTTGACTTAGGGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145963.1-1628s1c1
Sequence:CCGGCCACAGATAGACCACACCTTTCTCGAGAAAGGTGTGGTCTATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-228s1c1
Sequence:CCGGGAGCCAGGAAACAGTCGAGCTCTCGAGAGCTCGACTGTTTCCTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-935s1c1
Sequence:CCGGCCAGGATGTAGATGTTGGTTTCTCGAGAAACCAACATCTACATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145963
KCNJ14 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 14
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145963.2-1769s21c1
Sequence:CCGGGGTTGAACATCAGTGAGATACCTCGAGGTATCTCACTGATGTTCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-1218s1c1
Sequence:CCGGCGCCACTTCCATCGAACATATCTCGAGATATGTTCGATGGAAGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-1301s1c1
Sequence:CCGGCCACAGCCCTAAGTCAAGTTTCTCGAGAAACTTGACTTAGGGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145963.1-1628s1c1
Sequence:CCGGCCACAGATAGACCACACCTTTCTCGAGAAAGGTGTGGTCTATCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-228s1c1
Sequence:CCGGGAGCCAGGAAACAGTCGAGCTCTCGAGAGCTCGACTGTTTCCTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145963.1-935s1c1
Sequence:CCGGCCAGGATGTAGATGTTGGTTTCTCGAGAAACCAACATCTACATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013348
KCNJ14 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 14
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013348.2-580s21c1
Sequence:CCGGTGCAACGTGCGTTTCGTAAACCTCGAGGTTTACGAAACGCACGTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-550s1c1
Sequence:CCGGCGCGGTCGCTTCGTCAAGAAACTCGAGTTTCTTGACGAAGCGACCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-1527s1c1
Sequence:CCGGCCACAGCCTCAAGTCTAGTTTCTCGAGAAACTAGACTTGAGGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-1444s1c1
Sequence:CCGGCGCCACTTCCATCGCACTTATCTCGAGATAAGTGCGATGGAAGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-1621s1c1
Sequence:CCGGGATGAGACTGAGGAAGGGAATCTCGAGATTCCCTTCCTCAGTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-663s1c1
Sequence:CCGGGCGCTGGATGTGCCTGCTCTTCTCGAGAAGAGCAGGCACATCCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013348
KCNJ14 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 14
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013348.2-580s21c1
Sequence:CCGGTGCAACGTGCGTTTCGTAAACCTCGAGGTTTACGAAACGCACGTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-550s1c1
Sequence:CCGGCGCGGTCGCTTCGTCAAGAAACTCGAGTTTCTTGACGAAGCGACCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-1527s1c1
Sequence:CCGGCCACAGCCTCAAGTCTAGTTTCTCGAGAAACTAGACTTGAGGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-1444s1c1
Sequence:CCGGCGCCACTTCCATCGCACTTATCTCGAGATAAGTGCGATGGAAGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-1621s1c1
Sequence:CCGGGATGAGACTGAGGAAGGGAATCTCGAGATTCCCTTCCTCAGTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-663s1c1
Sequence:CCGGGCGCTGGATGTGCCTGCTCTTCTCGAGAAGAGCAGGCACATCCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013348
KCNJ14 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 14
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013348.2-580s21c1
Sequence:CCGGTGCAACGTGCGTTTCGTAAACCTCGAGGTTTACGAAACGCACGTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-550s1c1
Sequence:CCGGCGCGGTCGCTTCGTCAAGAAACTCGAGTTTCTTGACGAAGCGACCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-1527s1c1
Sequence:CCGGCCACAGCCTCAAGTCTAGTTTCTCGAGAAACTAGACTTGAGGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-1444s1c1
Sequence:CCGGCGCCACTTCCATCGCACTTATCTCGAGATAAGTGCGATGGAAGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-1621s1c1
Sequence:CCGGGATGAGACTGAGGAAGGGAATCTCGAGATTCCCTTCCTCAGTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013348.2-663s1c1
Sequence:CCGGGCGCTGGATGTGCCTGCTCTTCTCGAGAAGAGCAGGCACATCCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)