EMAIL THIS PAGE TO A FRIEND

KCNJ15

potassium inwardly-rectifying channel, subfamily J, member 15

104 Gene Product Result for
Synonyms: IRKK KIR1.3 KIR4.2
UniProtKB ID: Q99712, D3DSH5, O00564, Q96L28, Q99446
Gene ID:
Human(3772) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013]
Mouse(16516) potassium inwardly-rectifying channel, subfamily J, member 15
Rat(170847) potassium inwardly-rectifying channel, subfamily J, member 15
sheep(101117981) potassium inwardly-rectifying channel, subfamily J, member 15
Domestic Rabbit(100347016) potassium inwardly-rectifying channel, subfamily J, member 15
domestic guinea pig(100713999) potassium inwardly-rectifying channel, subfamily J, member 15
domestic guinea pig(100135565) potassium inwardly-rectifying channel, subfamily J, member 15
naked mole-rat(101718634) potassium inwardly-rectifying channel, subfamily J, member 15
chicken(427984) potassium inwardly-rectifying channel, subfamily J, member 15
dog(487759) potassium inwardly-rectifying channel, subfamily J, member 15
domestic cat(101100322) potassium inwardly-rectifying channel, subfamily J, member 15
cow(522184) potassium inwardly-rectifying channel, subfamily J, member 15
Horse(100051634) potassium inwardly-rectifying channel, subfamily J, member 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002243 Rosetta Predictions human pricing
NM_170736 Rosetta Predictions human pricing
NM_170737 Rosetta Predictions human pricing
NM_133321 Rosetta Predictions rat pricing
NM_001039056 Rosetta Predictions mouse pricing
NM_001039057 Rosetta Predictions mouse pricing
NM_019664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121076 predicted 1000
2 SASI_Hs01_00121077 predicted 762
3 SASI_Hs02_00333487 predicted 1512
4 SASI_Hs01_00121078 predicted 1036
5 SASI_Hs01_00121079 predicted 883
6 SASI_Hs01_00121080 predicted 465
7 SASI_Hs01_00121081 predicted 1467
8 SASI_Hs01_00121082 predicted 518
9 SASI_Hs01_00121083 predicted 1446
10 SASI_Hs01_00121085 predicted 551
11 SASI_Hs01_00121084 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019052 predicted 1047
2 SASI_Hs01_00019053 predicted 811
3 SASI_Hs02_00367688 predicted 1570
4 SASI_Hs01_00019054 predicted 1091
5 SASI_Hs01_00019055 predicted 938
6 SASI_Hs01_00019056 predicted 525
7 SASI_Hs01_00019057 predicted 1521
8 SASI_Hs01_00019058 predicted 570
9 SASI_Hs01_00019059 predicted 1496
10 SASI_Hs01_00019061 predicted 596
11 SASI_Hs01_00019060 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150218 predicted 863
2 SASI_Hs01_00150219 predicted 619
3 SASI_Hs02_00367689 predicted 1378
4 SASI_Hs01_00150220 predicted 900
5 SASI_Hs01_00150221 predicted 743
6 SASI_Hs01_00150222 predicted 336
7 SASI_Hs01_00150223 predicted 1332
8 SASI_Hs01_00150224 predicted 389
9 SASI_Hs01_00150225 predicted 1314
10 SASI_Hs01_00150227 predicted 415
11 SASI_Hs01_00150226 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044428 predicted 395
2 SASI_Rn02_00267630 predicted 499
3 SASI_Rn01_00044429 predicted 962
4 SASI_Rn01_00044430 predicted 1164
5 SASI_Rn01_00044431 predicted 668
6 SASI_Rn01_00044432 predicted 875
7 SASI_Rn01_00044434 predicted 903
8 SASI_Rn01_00044435 predicted 959
9 SASI_Rn01_00044436 predicted 1179
10 SASI_Rn01_00044437 predicted 1223
11 SASI_Rn01_00044433 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045324 predicted 951
2 SASI_Mm01_00045325 predicted 992
3 SASI_Mm01_00045326 predicted 747
4 SASI_Mm01_00045327 predicted 1254
5 SASI_Mm01_00045328 predicted 1443
6 SASI_Mm01_00045329 predicted 582
7 SASI_Mm01_00045330 predicted 1186
8 SASI_Mm01_00045331 predicted 1265
9 SASI_Mm01_00045332 predicted 544
10 SASI_Mm01_00045333 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079494 predicted 1043
2 SASI_Mm01_00079495 predicted 1080
3 SASI_Mm01_00079496 predicted 839
4 SASI_Mm01_00079497 predicted 1339
5 SASI_Mm01_00079498 predicted 1534
6 SASI_Mm01_00079499 predicted 672
7 SASI_Mm01_00079500 predicted 1273
8 SASI_Mm01_00079501 predicted 1356
9 SASI_Mm01_00079502 predicted 634
10 SASI_Mm01_00079503 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098938 predicted 1130
2 SASI_Mm01_00098939 predicted 1167
3 SASI_Mm01_00098940 predicted 924
4 SASI_Mm01_00098941 predicted 1431
5 SASI_Mm01_00098942 predicted 1621
6 SASI_Mm01_00098943 predicted 756
7 SASI_Mm01_00098944 predicted 1362
8 SASI_Mm01_00098945 predicted 1441
9 SASI_Mm01_00098946 predicted 716
10 SASI_Mm01_00098947 predicted 1482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002243
KCNJ15 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002243.3-555s21c1
Sequence:CCGGTACTATGCCATCGCGTTTATTCTCGAGAATAAACGCGATGGCATAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-479s1c1
Sequence:CCGGCGACATGAAGTGGAGATACAACTCGAGTTGTATCTCCACTTCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-852s1c1
Sequence:CCGGGCAGTCATCACCAAGCAGAATCTCGAGATTCTGCTTGGTGATGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-1332s1c1
Sequence:CCGGGCAGATTCTGAGAAACAGCAACTCGAGTTGCTGTTTCTCAGAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-1184s1c1
Sequence:CCGGCCAGAGCCGAACATCTTATATCTCGAGATATAAGATGTTCGGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-1239s1c1
Sequence:CCGGCCTGTGGTATCTCTCTCCAAACTCGAGTTTGGAGAGAGATACCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002243.3-1684s21c1
Sequence:CCGGAGAGCTTGGTGTAGGGCAATTCTCGAGAATTGCCCTACACCAAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002243.3-1706s21c1
Sequence:CCGGGAATAATGTCCTGTTAGATAACTCGAGTTATCTAACAGGACATTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002243.3-423s21c1
Sequence:CCGGGACAAAGTGGATGGCATATACCTCGAGGTATATGCCATCCACTTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002243
KCNJ15 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002243.3-555s21c1
Sequence:CCGGTACTATGCCATCGCGTTTATTCTCGAGAATAAACGCGATGGCATAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-479s1c1
Sequence:CCGGCGACATGAAGTGGAGATACAACTCGAGTTGTATCTCCACTTCATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-852s1c1
Sequence:CCGGGCAGTCATCACCAAGCAGAATCTCGAGATTCTGCTTGGTGATGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-1332s1c1
Sequence:CCGGGCAGATTCTGAGAAACAGCAACTCGAGTTGCTGTTTCTCAGAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-1184s1c1
Sequence:CCGGCCAGAGCCGAACATCTTATATCTCGAGATATAAGATGTTCGGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-1239s1c1
Sequence:CCGGCCTGTGGTATCTCTCTCCAAACTCGAGTTTGGAGAGAGATACCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002243.3-1684s21c1
Sequence:CCGGAGAGCTTGGTGTAGGGCAATTCTCGAGAATTGCCCTACACCAAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002243.3-1706s21c1
Sequence:CCGGGAATAATGTCCTGTTAGATAACTCGAGTTATCTAACAGGACATTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002243.3-423s21c1
Sequence:CCGGGACAAAGTGGATGGCATATACCTCGAGGTATATGCCATCCACTTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002243
KCNJ15 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002243.3-555s21c1
Sequence:CCGGTACTATGCCATCGCGTTTATTCTCGAGAATAAACGCGATGGCATAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-479s1c1
Sequence:CCGGCGACATGAAGTGGAGATACAACTCGAGTTGTATCTCCACTTCATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-852s1c1
Sequence:CCGGGCAGTCATCACCAAGCAGAATCTCGAGATTCTGCTTGGTGATGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-1332s1c1
Sequence:CCGGGCAGATTCTGAGAAACAGCAACTCGAGTTGCTGTTTCTCAGAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-1184s1c1
Sequence:CCGGCCAGAGCCGAACATCTTATATCTCGAGATATAAGATGTTCGGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002243.3-1239s1c1
Sequence:CCGGCCTGTGGTATCTCTCTCCAAACTCGAGTTTGGAGAGAGATACCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002243.3-1684s21c1
Sequence:CCGGAGAGCTTGGTGTAGGGCAATTCTCGAGAATTGCCCTACACCAAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002243.3-1706s21c1
Sequence:CCGGGAATAATGTCCTGTTAGATAACTCGAGTTATCTAACAGGACATTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002243.3-423s21c1
Sequence:CCGGGACAAAGTGGATGGCATATACCTCGAGGTATATGCCATCCACTTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019664
KCNJ15 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-486s1c1
Sequence:CCGGGCCTTTATTCATGGTGACTTACTCGAGTAAGTCACCATGAATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-1191s1c1
Sequence:CCGGGTGGCTGATTTCAGTCAATTTCTCGAGAAATTGACTGAAATCAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-411s1c1
Sequence:CCGGCGATACAAGCTCACCCTATTTCTCGAGAAATAGGGTGAGCTTGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-1158s1c1
Sequence:CCGGCCTGTGGTTTCTCTCTCCAAACTCGAGTTTGGAGAGAGAAACCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-398s1c1
Sequence:CCGGCGACATGAAGTGGCGATACAACTCGAGTTGTATCGCCACTTCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019664
KCNJ15 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-486s1c1
Sequence:CCGGGCCTTTATTCATGGTGACTTACTCGAGTAAGTCACCATGAATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-1191s1c1
Sequence:CCGGGTGGCTGATTTCAGTCAATTTCTCGAGAAATTGACTGAAATCAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-411s1c1
Sequence:CCGGCGATACAAGCTCACCCTATTTCTCGAGAAATAGGGTGAGCTTGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-1158s1c1
Sequence:CCGGCCTGTGGTTTCTCTCTCCAAACTCGAGTTTGGAGAGAGAAACCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-398s1c1
Sequence:CCGGCGACATGAAGTGGCGATACAACTCGAGTTGTATCGCCACTTCATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019664
KCNJ15 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-486s1c1
Sequence:CCGGGCCTTTATTCATGGTGACTTACTCGAGTAAGTCACCATGAATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-1191s1c1
Sequence:CCGGGTGGCTGATTTCAGTCAATTTCTCGAGAAATTGACTGAAATCAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-411s1c1
Sequence:CCGGCGATACAAGCTCACCCTATTTCTCGAGAAATAGGGTGAGCTTGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-1158s1c1
Sequence:CCGGCCTGTGGTTTCTCTCTCCAAACTCGAGTTTGGAGAGAGAAACCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019664.3-398s1c1
Sequence:CCGGCGACATGAAGTGGCGATACAACTCGAGTTGTATCGCCACTTCATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)