EMAIL THIS PAGE TO A FRIEND

KCNJ16

potassium inwardly-rectifying channel, subfamily J, member 16

77 Gene Product Result for
Synonyms: BIR9 KIR5.1
UniProtKB ID: Q9NPI9
Gene ID:
Human(3773) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, can form heterodimers with two other inward-rectifier type potassium channels. It may be involved in the regulation of fluid and pH balance. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(16517) potassium inwardly-rectifying channel, subfamily J, member 16
Rat(29719) potassium inwardly-rectifying channel, subfamily J, member 16
chicken(427812) potassium inwardly-rectifying channel, subfamily J, member 16
cow(613890) potassium inwardly-rectifying channel, subfamily J, member 16
dog(611045) potassium inwardly-rectifying channel, subfamily J, member 16
domestic cat(101090060) potassium inwardly-rectifying channel, subfamily J, member 16
domestic guinea pig(100379597) potassium inwardly-rectifying channel, subfamily J, member 16
naked mole-rat(101712921) potassium inwardly-rectifying channel, subfamily J, member 16
sheep(101114792) potassium inwardly-rectifying channel, subfamily J, member 16
Domestic Rabbit(100355482) potassium inwardly-rectifying channel, subfamily J, member 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018658 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018658 Rosetta Predictions human pricing
NM_170741 Rosetta Predictions human pricing
NM_170742 Rosetta Predictions human pricing
NM_053314 Rosetta Predictions rat pricing
NM_010604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090489 predicted 1453
2 SASI_Hs01_00090490 predicted 889
3 SASI_Hs01_00090491 predicted 720
4 SASI_Hs01_00090492 predicted 1230
5 SASI_Hs01_00090494 predicted 1126
6 SASI_Hs01_00090495 predicted 1406
7 SASI_Hs01_00090496 predicted 1130
8 SASI_Hs01_00090497 predicted 940
9 SASI_Hs01_00090498 predicted 1317
10 SASI_Hs02_00352161 predicted 1465
11 SASI_Hs01_00090493 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160721 predicted 1371
2 SASI_Hs01_00160722 predicted 799
3 SASI_Hs01_00160723 predicted 635
4 SASI_Hs01_00160724 predicted 1150
5 SASI_Hs01_00160726 predicted 1045
6 SASI_Hs01_00160727 predicted 1326
7 SASI_Hs01_00160728 predicted 1049
8 SASI_Hs01_00160729 predicted 857
9 SASI_Hs01_00160730 predicted 1236
10 SASI_Hs02_00367707 predicted 1378
11 SASI_Hs01_00160725 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222192 predicted 1458
2 SASI_Hs01_00222193 predicted 891
3 SASI_Hs01_00222194 predicted 722
4 SASI_Hs01_00222195 predicted 1235
5 SASI_Hs01_00222197 predicted 1135
6 SASI_Hs01_00222198 predicted 1409
7 SASI_Hs01_00222199 predicted 1141
8 SASI_Hs01_00222200 predicted 946
9 SASI_Hs01_00222201 predicted 1325
10 SASI_Hs02_00367708 predicted 1471
11 SASI_Hs01_00222196 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112822 predicted 689
2 SASI_Rn01_00112823 predicted 858
3 SASI_Rn01_00112824 predicted 1400
4 SASI_Rn01_00112825 predicted 959
5 SASI_Rn01_00112826 predicted 791
6 SASI_Rn01_00112827 predicted 233
7 SASI_Rn01_00112828 predicted 871
8 SASI_Rn02_00265735 predicted 967
9 SASI_Rn01_00112829 predicted 281
10 SASI_Rn01_00112830 predicted 292
11 SASI_Rn01_00112821 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151961 predicted 982
2 SASI_Mm01_00151962 predicted 1213
3 SASI_Mm01_00151963 predicted 915
4 SASI_Mm01_00151964 predicted 692
5 SASI_Mm01_00151965 predicted 1520
6 SASI_Mm01_00151966 predicted 813
7 SASI_Mm02_00318918 predicted 419
8 SASI_Mm01_00151970 predicted 998
9 SASI_Mm01_00151969 predicted 359
10 SASI_Mm02_00318919 predicted 1093
11 SASI_Mm01_00151967 predicted 1182
12 SASI_Mm01_00151968 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010604
KCNJ16 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 16
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010604.3-818s21c1
Sequence:CCGGGAGCCCAACTTCTGCGCTATTCTCGAGAATAGCGCAGAAGTTGGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010604.3-458s21c1
Sequence:CCGGTTCATCACGGAGACCTATTAACTCGAGTTAATAGGTCTCCGTGATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010604.3-1784s21c1
Sequence:CCGGATGAGAACTTATAACCGTATTCTCGAGAATACGGTTATAAGTTCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010604.2-2982s1c1
Sequence:CCGGCCTTTGTTACTCAGGATCAATCTCGAGATTGATCCTGAGTAACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-1103s1c1
Sequence:CCGGCCAGTCCAGAAGTTCCTACATCTCGAGATGTAGGAACTTCTGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-569s1c1
Sequence:CCGGGCATTCATTTACGGCTGCATTCTCGAGAATGCAGCCGTAAATGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-1038s1c1
Sequence:CCGGGCCAAAGATAATTTCGAGATTCTCGAGAATCTCGAAATTATCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-972s1c1
Sequence:CCGGCCAGTGACTATTGTCCATGAACTCGAGTTCATGGACAATAGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010604
KCNJ16 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 16
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010604.3-818s21c1
Sequence:CCGGGAGCCCAACTTCTGCGCTATTCTCGAGAATAGCGCAGAAGTTGGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010604.3-458s21c1
Sequence:CCGGTTCATCACGGAGACCTATTAACTCGAGTTAATAGGTCTCCGTGATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010604.3-1784s21c1
Sequence:CCGGATGAGAACTTATAACCGTATTCTCGAGAATACGGTTATAAGTTCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010604.2-2982s1c1
Sequence:CCGGCCTTTGTTACTCAGGATCAATCTCGAGATTGATCCTGAGTAACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-1103s1c1
Sequence:CCGGCCAGTCCAGAAGTTCCTACATCTCGAGATGTAGGAACTTCTGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-569s1c1
Sequence:CCGGGCATTCATTTACGGCTGCATTCTCGAGAATGCAGCCGTAAATGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-1038s1c1
Sequence:CCGGGCCAAAGATAATTTCGAGATTCTCGAGAATCTCGAAATTATCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-972s1c1
Sequence:CCGGCCAGTGACTATTGTCCATGAACTCGAGTTCATGGACAATAGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010604
KCNJ16 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 16
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010604.3-818s21c1
Sequence:CCGGGAGCCCAACTTCTGCGCTATTCTCGAGAATAGCGCAGAAGTTGGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010604.3-458s21c1
Sequence:CCGGTTCATCACGGAGACCTATTAACTCGAGTTAATAGGTCTCCGTGATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010604.3-1784s21c1
Sequence:CCGGATGAGAACTTATAACCGTATTCTCGAGAATACGGTTATAAGTTCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010604.2-2982s1c1
Sequence:CCGGCCTTTGTTACTCAGGATCAATCTCGAGATTGATCCTGAGTAACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-1103s1c1
Sequence:CCGGCCAGTCCAGAAGTTCCTACATCTCGAGATGTAGGAACTTCTGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-569s1c1
Sequence:CCGGGCATTCATTTACGGCTGCATTCTCGAGAATGCAGCCGTAAATGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-1038s1c1
Sequence:CCGGGCCAAAGATAATTTCGAGATTCTCGAGAATCTCGAAATTATCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010604.2-972s1c1
Sequence:CCGGCCAGTGACTATTGTCCATGAACTCGAGTTCATGGACAATAGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018658
KCNJ16 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 16
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018658.1-1200s21c1
Sequence:CCGGCAAATTAGTCAACGACCAAATCTCGAGATTTGGTCGTTGACTAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018658.1-1589s21c1
Sequence:CCGGAGGCGAGACGAAGGTCATTTACTCGAGTAAATGACCTTCGTCTCGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-1234s1c1
Sequence:CCGGCCGGTAACTATTGTCCATGAACTCGAGTTCATGGACAATAGTTACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-1300s1c1
Sequence:CCGGGCCAAAGATAACTTTGAGATTCTCGAGAATCTCAAAGTTATCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-896s1c1
Sequence:CCGGGCTGTGTTACTGAAGAATGTTCTCGAGAACATTCTTCAGTAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-773s1c1
Sequence:CCGGCCTTTCATCATGGCGATCTATCTCGAGATAGATCGCCATGATGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-1664s1c1
Sequence:CCGGCCACACATGAATATAGGGAAACTCGAGTTTCCCTATATTCATGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018658
KCNJ16 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 16
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018658.1-1200s21c1
Sequence:CCGGCAAATTAGTCAACGACCAAATCTCGAGATTTGGTCGTTGACTAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018658.1-1589s21c1
Sequence:CCGGAGGCGAGACGAAGGTCATTTACTCGAGTAAATGACCTTCGTCTCGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-1234s1c1
Sequence:CCGGCCGGTAACTATTGTCCATGAACTCGAGTTCATGGACAATAGTTACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-1300s1c1
Sequence:CCGGGCCAAAGATAACTTTGAGATTCTCGAGAATCTCAAAGTTATCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-896s1c1
Sequence:CCGGGCTGTGTTACTGAAGAATGTTCTCGAGAACATTCTTCAGTAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-773s1c1
Sequence:CCGGCCTTTCATCATGGCGATCTATCTCGAGATAGATCGCCATGATGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-1664s1c1
Sequence:CCGGCCACACATGAATATAGGGAAACTCGAGTTTCCCTATATTCATGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018658
KCNJ16 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 16
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018658.1-1200s21c1
Sequence:CCGGCAAATTAGTCAACGACCAAATCTCGAGATTTGGTCGTTGACTAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018658.1-1589s21c1
Sequence:CCGGAGGCGAGACGAAGGTCATTTACTCGAGTAAATGACCTTCGTCTCGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-1234s1c1
Sequence:CCGGCCGGTAACTATTGTCCATGAACTCGAGTTCATGGACAATAGTTACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-1300s1c1
Sequence:CCGGGCCAAAGATAACTTTGAGATTCTCGAGAATCTCAAAGTTATCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-896s1c1
Sequence:CCGGGCTGTGTTACTGAAGAATGTTCTCGAGAACATTCTTCAGTAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-773s1c1
Sequence:CCGGCCTTTCATCATGGCGATCTATCTCGAGATAGATCGCCATGATGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018658.1-1664s1c1
Sequence:CCGGCCACACATGAATATAGGGAAACTCGAGTTTCCCTATATTCATGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)