EMAIL THIS PAGE TO A FRIEND

KCNJ1

potassium inwardly-rectifying channel, subfamily J, member 1

119 Gene Product Result for
Synonyms: KIR1.1 ROMK ROMK1
UniProtKB ID: P48048, B2RMR4, Q6LD67
Gene ID:
Human(3758) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. It is activated by internal ATP and probably plays an important role in potassium homeostasis. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Mutations in this gene have been associated with antenatal Bartter syndrome, which is characterized by salt wasting, hypokalemic alkalosis, hypercalciuria, and low blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56379) potassium inwardly-rectifying channel, subfamily J, member 1
Rat(24521) potassium inwardly-rectifying channel, subfamily J, member 1
chicken(428236) potassium inwardly-rectifying channel, subfamily J, member 1
dog(489285) potassium inwardly-rectifying channel, subfamily J, member 1
domestic cat(101091140) potassium inwardly-rectifying channel, subfamily J, member 1
cow(539250) potassium inwardly-rectifying channel, subfamily J, member 1
Horse(100072580) potassium inwardly-rectifying channel, subfamily J, member 1
domestic guinea pig(100722828) potassium inwardly-rectifying channel, subfamily J, member 1
naked mole-rat(101720253) potassium inwardly-rectifying channel, subfamily J, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Activator

Product # Description Species Add to Cart
 
D9035 Diazoxide human, mouse, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
N7634 Nifedipine ≥98% (HPLC), powder human, mouse, rat pricing
G2539 Glyburide meets USP testing specifications human, rat pricing
C1055 Cromakalim rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
G2167 Gliclazide powder, ≥98% human pricing
R9028 Repaglinide ≥98% (HPLC), solid human pricing

Small Molecule - Opener

Product # Description Species Add to Cart
 
M4145 Minoxidil ≥99% (TLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153764 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061211 MISSION® esiRNA esiRNA human KCNJ1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000220 Rosetta Predictions human pricing
NM_153764 Rosetta Predictions human pricing
NM_153765 Rosetta Predictions human pricing
NM_153766 Rosetta Predictions human pricing
NM_153767 Rosetta Predictions human pricing
NM_017023 Rosetta Predictions rat pricing
NM_019659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228234 predicted 526
2 SASI_Hs01_00228235 predicted 735
3 SASI_Hs01_00228236 predicted 1282
4 SASI_Hs01_00228237 predicted 706
5 SASI_Hs01_00228238 predicted 1250
6 SASI_Hs01_00228239 predicted 983
7 SASI_Hs01_00228240 predicted 920
8 SASI_Hs01_00228241 predicted 455
9 SASI_Hs01_00228242 predicted 590
10 SASI_Hs01_00228243 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138024 predicted 634
2 SASI_Hs01_00138025 predicted 851
3 SASI_Hs01_00138026 predicted 1394
4 SASI_Hs01_00138027 predicted 822
5 SASI_Hs01_00138028 predicted 1369
6 SASI_Hs01_00138029 predicted 1099
7 SASI_Hs01_00138030 predicted 1033
8 SASI_Hs01_00138031 predicted 568
9 SASI_Hs01_00138032 predicted 703
10 SASI_Hs01_00138033 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187171 predicted 768
2 SASI_Hs01_00187172 predicted 978
3 SASI_Hs01_00187173 predicted 1526
4 SASI_Hs01_00187174 predicted 949
5 SASI_Hs01_00187175 predicted 1494
6 SASI_Hs01_00187176 predicted 1227
7 SASI_Hs01_00187177 predicted 1162
8 SASI_Hs01_00187178 predicted 704
9 SASI_Hs01_00187179 predicted 831
10 SASI_Hs01_00187180 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047540 predicted 802
2 SASI_Hs01_00047541 predicted 1013
3 SASI_Hs01_00047542 predicted 1558
4 SASI_Hs01_00047543 predicted 986
5 SASI_Hs01_00047544 predicted 1539
6 SASI_Hs01_00047545 predicted 1260
7 SASI_Hs01_00047546 predicted 1195
8 SASI_Hs01_00047547 predicted 746
9 SASI_Hs01_00047548 predicted 868
10 SASI_Hs01_00047549 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094059 predicted 938
2 SASI_Hs01_00094060 predicted 1152
3 SASI_Hs01_00094061 predicted 1697
4 SASI_Hs01_00094062 predicted 1116
5 SASI_Hs01_00094063 predicted 1673
6 SASI_Hs01_00094064 predicted 1395
7 SASI_Hs01_00094065 predicted 1336
8 SASI_Hs01_00094066 predicted 877
9 SASI_Hs01_00094067 predicted 998
10 SASI_Hs01_00094068 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037265 predicted 435
2 SASI_Rn02_00261193 predicted 218
3 SASI_Rn02_00261194 predicted 532
4 SASI_Rn01_00037266 predicted 688
5 SASI_Rn01_00037267 predicted 1274
6 SASI_Rn02_00261195 predicted 350
7 SASI_Rn01_00037269 predicted 303
8 SASI_Rn01_00037270 predicted 555
9 SASI_Rn01_00037272 predicted 625
10 SASI_Rn01_00037273 predicted 814
11 SASI_Rn01_00037268 predicted 1021
12 SASI_Rn01_00037271 predicted 234
13 SASI_Rn01_00037274 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021132 predicted 449
2 SASI_Mm02_00324709 predicted 692
3 SASI_Mm01_00021133 predicted 539
4 SASI_Mm01_00021134 predicted 960
5 SASI_Mm01_00021135 predicted 231
6 SASI_Mm01_00021136 predicted 1292
7 SASI_Mm01_00021137 predicted 894
8 SASI_Mm01_00021138 predicted 677
9 SASI_Mm01_00021139 predicted 637
10 SASI_Mm01_00021140 predicted 1349
11 SASI_Mm01_00021141 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019659
KCNJ1 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019659.2-2185s1c1
Sequence:CCGGCCTCCAACAATCACATACAAACTCGAGTTTGTATGTGATTGTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-1093s1c1
Sequence:CCGGCGCACATCATACATCCCAGAACTCGAGTTCTGGGATGTATGATGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-1288s1c1
Sequence:CCGGCCTAACTTTGTCTTGTCAGAACTCGAGTTCTGACAAGACAAAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-1173s1c1
Sequence:CCGGCCGAGTGGATTTCCATAACTTCTCGAGAAGTTATGGAAATCCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-796s1c1
Sequence:CCGGCGAGTAGCAAATCTTAGGAAACTCGAGTTTCCTAAGATTTGCTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019659
KCNJ1 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019659.2-2185s1c1
Sequence:CCGGCCTCCAACAATCACATACAAACTCGAGTTTGTATGTGATTGTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-1093s1c1
Sequence:CCGGCGCACATCATACATCCCAGAACTCGAGTTCTGGGATGTATGATGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-1288s1c1
Sequence:CCGGCCTAACTTTGTCTTGTCAGAACTCGAGTTCTGACAAGACAAAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-1173s1c1
Sequence:CCGGCCGAGTGGATTTCCATAACTTCTCGAGAAGTTATGGAAATCCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-796s1c1
Sequence:CCGGCGAGTAGCAAATCTTAGGAAACTCGAGTTTCCTAAGATTTGCTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019659
KCNJ1 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019659.2-2185s1c1
Sequence:CCGGCCTCCAACAATCACATACAAACTCGAGTTTGTATGTGATTGTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-1093s1c1
Sequence:CCGGCGCACATCATACATCCCAGAACTCGAGTTCTGGGATGTATGATGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-1288s1c1
Sequence:CCGGCCTAACTTTGTCTTGTCAGAACTCGAGTTCTGACAAGACAAAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-1173s1c1
Sequence:CCGGCCGAGTGGATTTCCATAACTTCTCGAGAAGTTATGGAAATCCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019659.2-796s1c1
Sequence:CCGGCGAGTAGCAAATCTTAGGAAACTCGAGTTTCCTAAGATTTGCTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153764
KCNJ1 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153764.1-1848s1c1
Sequence:CCGGCGCTTACACAAAGAACAATTTCTCGAGAAATTGTTCTTTGTGTAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-1291s1c1
Sequence:CCGGCCCAACTTCATCTTGTCAGAACTCGAGTTCTGACAAGATGAAGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-1177s1c1
Sequence:CCGGCGAGTGGATTTCCATAACTTTCTCGAGAAAGTTATGGAAATCCACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-652s1c1
Sequence:CCGGCAGTCTATACTTGGAGTTATACTCGAGTATAACTCCAAGTATAGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-466s1c1
Sequence:CCGGGCAGTAGCGTACATTCACAAACTCGAGTTTGTGAATGTACGCTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153764.1-1401s21c1
Sequence:CCGGTATGAAGCAGTCAACAATTTACTCGAGTAAATTGTTGACTGCTTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153764.1-899s21c1
Sequence:CCGGACCAGATCAATATCAACTTTGCTCGAGCAAAGTTGATATTGATCTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153764.1-1530s21c1
Sequence:CCGGGAACGTGCAATGCATTTATATCTCGAGATATAAATGCATTGCACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153764
KCNJ1 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153764.1-1848s1c1
Sequence:CCGGCGCTTACACAAAGAACAATTTCTCGAGAAATTGTTCTTTGTGTAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-1291s1c1
Sequence:CCGGCCCAACTTCATCTTGTCAGAACTCGAGTTCTGACAAGATGAAGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-1177s1c1
Sequence:CCGGCGAGTGGATTTCCATAACTTTCTCGAGAAAGTTATGGAAATCCACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-652s1c1
Sequence:CCGGCAGTCTATACTTGGAGTTATACTCGAGTATAACTCCAAGTATAGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-466s1c1
Sequence:CCGGGCAGTAGCGTACATTCACAAACTCGAGTTTGTGAATGTACGCTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153764.1-1401s21c1
Sequence:CCGGTATGAAGCAGTCAACAATTTACTCGAGTAAATTGTTGACTGCTTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153764.1-899s21c1
Sequence:CCGGACCAGATCAATATCAACTTTGCTCGAGCAAAGTTGATATTGATCTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153764.1-1530s21c1
Sequence:CCGGGAACGTGCAATGCATTTATATCTCGAGATATAAATGCATTGCACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153764
KCNJ1 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153764.1-1848s1c1
Sequence:CCGGCGCTTACACAAAGAACAATTTCTCGAGAAATTGTTCTTTGTGTAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-1291s1c1
Sequence:CCGGCCCAACTTCATCTTGTCAGAACTCGAGTTCTGACAAGATGAAGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-1177s1c1
Sequence:CCGGCGAGTGGATTTCCATAACTTTCTCGAGAAAGTTATGGAAATCCACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-652s1c1
Sequence:CCGGCAGTCTATACTTGGAGTTATACTCGAGTATAACTCCAAGTATAGACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153764.1-466s1c1
Sequence:CCGGGCAGTAGCGTACATTCACAAACTCGAGTTTGTGAATGTACGCTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153764.1-1401s21c1
Sequence:CCGGTATGAAGCAGTCAACAATTTACTCGAGTAAATTGTTGACTGCTTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153764.1-899s21c1
Sequence:CCGGACCAGATCAATATCAACTTTGCTCGAGCAAAGTTGATATTGATCTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153764.1-1530s21c1
Sequence:CCGGGAACGTGCAATGCATTTATATCTCGAGATATAAATGCATTGCACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)