EMAIL THIS PAGE TO A FRIEND

KCNJ2

potassium inwardly-rectifying channel, subfamily J, member 2

273 Gene Product Result for
Synonyms: ATFB9 HHBIRK1 HHIRK1 IRK1 KIR2.1 LQT7 SQT3
UniProtKB ID: P63252, O15110, P48049
Gene ID:
Human(3759) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, probably participates in establishing action potential waveform and excitability of neuronal and muscle tissues. Mutations in this gene have been associated with Andersen syndrome, which is characterized by periodic paralysis, cardiac arrhythmias, and dysmorphic features. [provided by RefSeq, Jul 2008]
Mouse(16518) potassium inwardly-rectifying channel, subfamily J, member 2
Rat(29712) potassium inwardly-rectifying channel, subfamily J, member 2
Zebrafish(564522) potassium inwardly-rectifying channel, subfamily J, member 2
chicken(396328) potassium inwardly-rectifying channel, subfamily J, member 2
cow(281883) potassium inwardly-rectifying channel, subfamily J, member 2
domestic cat(101090306) potassium inwardly-rectifying channel, subfamily J, member 2
dog(403717) potassium inwardly-rectifying channel, subfamily J, member 2
sheep(101114538) potassium inwardly-rectifying channel, subfamily J, member 2
Domestic Rabbit(100008987) potassium inwardly-rectifying channel, subfamily J, member 2
domestic guinea pig(100135566) potassium inwardly-rectifying channel, subfamily J, member 2
naked mole-rat(101714004) potassium inwardly-rectifying channel, subfamily J, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000891 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019661 MISSION® esiRNA esiRNA targeting human KCNJ2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000891 Rosetta Predictions human pricing
NM_017296 Rosetta Predictions rat pricing
NM_008425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126464 predicted 1104
2 SASI_Hs02_00303443 predicted 1239
3 SASI_Hs02_00303444 predicted 1400
4 SASI_Hs01_00126466 predicted 940
5 SASI_Hs01_00126467 predicted 1139
6 SASI_Hs01_00126468 predicted 1176
7 SASI_Hs01_00126469 predicted 1355
8 SASI_Hs01_00126470 predicted 414
9 SASI_Hs01_00126472 predicted 477
10 SASI_Hs01_00126473 predicted 804
11 SASI_Hs01_00126465 predicted 1676
12 SASI_Hs01_00126471 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261734 predicted 827
2 SASI_Rn01_00076923 predicted 1016
3 SASI_Rn01_00076924 predicted 849
4 SASI_Rn01_00076926 predicted 866
5 SASI_Rn01_00076927 predicted 791
6 SASI_Rn01_00076928 predicted 417
7 SASI_Rn01_00076929 predicted 589
8 SASI_Rn01_00076930 predicted 738
9 SASI_Rn01_00076931 predicted 429
10 SASI_Rn01_00076932 predicted 1022
11 SASI_Rn01_00076925 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059355 predicted 970
2 SASI_Mm01_00059356 predicted 1418
3 SASI_Mm01_00059357 predicted 501
4 SASI_Mm01_00059358 predicted 1206
5 SASI_Mm01_00059359 predicted 818
6 SASI_Mm01_00059360 predicted 553
7 SASI_Mm01_00059361 predicted 548
8 SASI_Mm01_00059362 predicted 1436
9 SASI_Mm01_00059363 predicted 1169
10 SASI_Mm01_00059364 predicted 1571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008425
KCNJ2 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1238s1c1
Sequence:CCGGCCCTTTATATGACTTGAGTAACTCGAGTTACTCAAGTCATATAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1203s1c1
Sequence:CCGGCCCATCACTATCGTTCACGAACTCGAGTTCGTGAACGATAGTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-957s1c1
Sequence:CCGGGCAAAGCCAAAGAAGAGAAATCTCGAGATTTCTCTTCTTTGGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1469s1c1
Sequence:CCGGCCTTTGTAGTGCCAGAGACTTCTCGAGAAGTCTCTGGCACTACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1394s1c1
Sequence:CCGGGCTCTTTGAAGAGAAACACTACTCGAGTAGTGTTTCTCTTCAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008425
KCNJ2 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1238s1c1
Sequence:CCGGCCCTTTATATGACTTGAGTAACTCGAGTTACTCAAGTCATATAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1203s1c1
Sequence:CCGGCCCATCACTATCGTTCACGAACTCGAGTTCGTGAACGATAGTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-957s1c1
Sequence:CCGGGCAAAGCCAAAGAAGAGAAATCTCGAGATTTCTCTTCTTTGGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1469s1c1
Sequence:CCGGCCTTTGTAGTGCCAGAGACTTCTCGAGAAGTCTCTGGCACTACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1394s1c1
Sequence:CCGGGCTCTTTGAAGAGAAACACTACTCGAGTAGTGTTTCTCTTCAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008425
KCNJ2 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1238s1c1
Sequence:CCGGCCCTTTATATGACTTGAGTAACTCGAGTTACTCAAGTCATATAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1203s1c1
Sequence:CCGGCCCATCACTATCGTTCACGAACTCGAGTTCGTGAACGATAGTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-957s1c1
Sequence:CCGGGCAAAGCCAAAGAAGAGAAATCTCGAGATTTCTCTTCTTTGGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1469s1c1
Sequence:CCGGCCTTTGTAGTGCCAGAGACTTCTCGAGAAGTCTCTGGCACTACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008425.2-1394s1c1
Sequence:CCGGGCTCTTTGAAGAGAAACACTACTCGAGTAGTGTTTCTCTTCAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000891
KCNJ2 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-1321s1c1
Sequence:CCGGGCTCTTATCTAGCAAATGAAACTCGAGTTTCATTTGCTAGATAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-1385s1c1
Sequence:CCGGGCACTACTACAAAGTGGACTACTCGAGTAGTCCACTTTGTAGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-539s1c1
Sequence:CCGGCCACTGTAATGTTCAGTTCATCTCGAGATGAACTGAACATTACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-831s1c1
Sequence:CCGGGTCACGGATGAATGCCCAATTCTCGAGAATTGGGCATTCATCCGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-1116s1c1
Sequence:CCGGCTGGATCAAATAGACATCAATCTCGAGATTGATGTCTATTTGATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000891.2-1680s21c1
Sequence:CCGGTTCTCTGGAATAGTTACTTTACTCGAGTAAAGTAACTATTCCAGAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000891.2-1148s21c1
Sequence:CCGGCAGTGGAATCGATCGTATATTCTCGAGAATATACGATCGATTCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000891
KCNJ2 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-1321s1c1
Sequence:CCGGGCTCTTATCTAGCAAATGAAACTCGAGTTTCATTTGCTAGATAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-1385s1c1
Sequence:CCGGGCACTACTACAAAGTGGACTACTCGAGTAGTCCACTTTGTAGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-539s1c1
Sequence:CCGGCCACTGTAATGTTCAGTTCATCTCGAGATGAACTGAACATTACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-831s1c1
Sequence:CCGGGTCACGGATGAATGCCCAATTCTCGAGAATTGGGCATTCATCCGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-1116s1c1
Sequence:CCGGCTGGATCAAATAGACATCAATCTCGAGATTGATGTCTATTTGATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000891.2-1680s21c1
Sequence:CCGGTTCTCTGGAATAGTTACTTTACTCGAGTAAAGTAACTATTCCAGAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000891.2-1148s21c1
Sequence:CCGGCAGTGGAATCGATCGTATATTCTCGAGAATATACGATCGATTCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000891
KCNJ2 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-1321s1c1
Sequence:CCGGGCTCTTATCTAGCAAATGAAACTCGAGTTTCATTTGCTAGATAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-1385s1c1
Sequence:CCGGGCACTACTACAAAGTGGACTACTCGAGTAGTCCACTTTGTAGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-539s1c1
Sequence:CCGGCCACTGTAATGTTCAGTTCATCTCGAGATGAACTGAACATTACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-831s1c1
Sequence:CCGGGTCACGGATGAATGCCCAATTCTCGAGAATTGGGCATTCATCCGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000891.2-1116s1c1
Sequence:CCGGCTGGATCAAATAGACATCAATCTCGAGATTGATGTCTATTTGATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000891.2-1680s21c1
Sequence:CCGGTTCTCTGGAATAGTTACTTTACTCGAGTAAAGTAACTATTCCAGAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000891.2-1148s21c1
Sequence:CCGGCAGTGGAATCGATCGTATATTCTCGAGAATATACGATCGATTCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)