EMAIL THIS PAGE TO A FRIEND

KCNJ3

potassium inwardly-rectifying channel, subfamily J, member 3

121 Gene Product Result for
Synonyms: GIRK1 KGA KIR3.1
UniProtKB ID: P48549, B4DEW7, Q8TBI0
Gene ID:
Human(3760) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and plays an important role in regulating heartbeat. It associates with three other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex that also couples to neurotransmitter receptors in the brain and whereby channel activation can inhibit action potential firing by hyperpolarizing the plasma membrane. These multimeric G-protein-gated inwardly-rectifying potassium (GIRK) channels may play a role in the pathophysiology of epilepsy, addiction, Down's syndrome, ataxia, and Parkinson's disease. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, May 2012]
Mouse(16519) potassium inwardly-rectifying channel, subfamily J, member 3
Rat(50599) potassium inwardly-rectifying channel, subfamily J, member 3
chicken(396369) potassium inwardly-rectifying channel, subfamily J, member 3
domestic cat(101088179) potassium inwardly-rectifying channel, subfamily J, member 3
cow(526088) potassium inwardly-rectifying channel, subfamily J, member 3
dog(488355) potassium inwardly-rectifying channel, subfamily J, member 3
domestic guinea pig(100190980) potassium inwardly-rectifying channel, subfamily J, member 3
naked mole-rat(101718832) potassium inwardly-rectifying channel, subfamily J, member 3
sheep(101115095) potassium inwardly-rectifying channel, subfamily J, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002239 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002239 Rosetta Predictions human pricing
NM_031610 Rosetta Predictions rat pricing
NM_008426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061481 predicted 1493
2 SASI_Hs02_00333481 predicted 1435
3 SASI_Hs01_00061482 predicted 1644
4 SASI_Hs01_00061483 predicted 1110
5 SASI_Hs01_00061484 predicted 1676
6 SASI_Hs01_00061485 predicted 995
7 SASI_Hs02_00333482 predicted 891
8 SASI_Hs01_00061487 predicted 1357
9 SASI_Hs01_00061488 predicted 1099
10 SASI_Hs01_00061489 predicted 1755
11 SASI_Hs01_00061486 predicted 1735
12 SASI_Hs01_00061490 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092735 predicted 1216
2 SASI_Rn01_00092736 predicted 1064
3 SASI_Rn01_00092737 predicted 959
4 SASI_Rn02_00264901 predicted 856
5 SASI_Rn01_00092738 predicted 1458
6 SASI_Rn01_00092739 predicted 974
7 SASI_Rn02_00264902 predicted 971
8 SASI_Rn01_00092741 predicted 1205
9 SASI_Rn01_00092742 predicted 656
10 SASI_Rn01_00092743 predicted 1509
11 SASI_Rn01_00092740 predicted 1607
12 SASI_Rn01_00092744 predicted 1565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133853 predicted 1441
2 SASI_Mm01_00133854 predicted 1319
3 SASI_Mm01_00133855 predicted 1048
4 SASI_Mm02_00313892 predicted 1192
5 SASI_Mm01_00133857 predicted 962
6 SASI_Mm01_00133858 predicted 1344
7 SASI_Mm01_00133859 predicted 1328
8 SASI_Mm01_00133860 predicted 621
9 SASI_Mm01_00133861 predicted 637
10 SASI_Mm01_00133862 predicted 845
11 SASI_Mm01_00133856 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002239
KCNJ3 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002239.2-2084s21c1
Sequence:CCGGGAATAGCTTTCAGGGCGATAACTCGAGTTATCGCCCTGAAAGCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-569s1c1
Sequence:CCGGCCAATGTCTATAACTTCCCTTCTCGAGAAGGGAAGTTATAGACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-1495s1c1
Sequence:CCGGCCCATGAAACTTCAACGAATACTCGAGTATTCGTTGAAGTTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-1315s1c1
Sequence:CCGGCCAGCCATAACTAACAGCAAACTCGAGTTTGCTGTTAGTTATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-1358s1c1
Sequence:CCGGGCTTAGATGGACTAGATGATACTCGAGTATCATCTAGTCCATCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-996s1c1
Sequence:CCGGCCTCACAATTTGCCACGTGATCTCGAGATCACGTGGCAAATTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002239.2-1872s21c1
Sequence:CCGGTACGGAGGGAGGACATCATAACTCGAGTTATGATGTCCTCCCTCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002239
KCNJ3 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002239.2-2084s21c1
Sequence:CCGGGAATAGCTTTCAGGGCGATAACTCGAGTTATCGCCCTGAAAGCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-569s1c1
Sequence:CCGGCCAATGTCTATAACTTCCCTTCTCGAGAAGGGAAGTTATAGACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-1495s1c1
Sequence:CCGGCCCATGAAACTTCAACGAATACTCGAGTATTCGTTGAAGTTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-1315s1c1
Sequence:CCGGCCAGCCATAACTAACAGCAAACTCGAGTTTGCTGTTAGTTATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-1358s1c1
Sequence:CCGGGCTTAGATGGACTAGATGATACTCGAGTATCATCTAGTCCATCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-996s1c1
Sequence:CCGGCCTCACAATTTGCCACGTGATCTCGAGATCACGTGGCAAATTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002239.2-1872s21c1
Sequence:CCGGTACGGAGGGAGGACATCATAACTCGAGTTATGATGTCCTCCCTCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002239
KCNJ3 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002239.2-2084s21c1
Sequence:CCGGGAATAGCTTTCAGGGCGATAACTCGAGTTATCGCCCTGAAAGCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-569s1c1
Sequence:CCGGCCAATGTCTATAACTTCCCTTCTCGAGAAGGGAAGTTATAGACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-1495s1c1
Sequence:CCGGCCCATGAAACTTCAACGAATACTCGAGTATTCGTTGAAGTTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-1315s1c1
Sequence:CCGGCCAGCCATAACTAACAGCAAACTCGAGTTTGCTGTTAGTTATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-1358s1c1
Sequence:CCGGGCTTAGATGGACTAGATGATACTCGAGTATCATCTAGTCCATCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002239.2-996s1c1
Sequence:CCGGCCTCACAATTTGCCACGTGATCTCGAGATCACGTGGCAAATTGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002239.2-1872s21c1
Sequence:CCGGTACGGAGGGAGGACATCATAACTCGAGTTATGATGTCCTCCCTCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008426
KCNJ3 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1486s1c1
Sequence:CCGGCCTACCAGGATGGAAGGAAATCTCGAGATTTCCTTCCATCCTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1345s1c1
Sequence:CCGGCCCATGAAACTCCAACGAATACTCGAGTATTCGTTGGAGTTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-285s1c1
Sequence:CCGGGCGTTGGAACCTCTTTATCTTCTCGAGAAGATAAAGAGGTTCCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1152s1c1
Sequence:CCGGCCCTTTAATAGCACCAGCCATCTCGAGATGGCTGGTGCTATTAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1125s1c1
Sequence:CCGGGCAGGAGGAAATGCTTCTCATCTCGAGATGAGAAGCATTTCCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008426
KCNJ3 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1486s1c1
Sequence:CCGGCCTACCAGGATGGAAGGAAATCTCGAGATTTCCTTCCATCCTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1345s1c1
Sequence:CCGGCCCATGAAACTCCAACGAATACTCGAGTATTCGTTGGAGTTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-285s1c1
Sequence:CCGGGCGTTGGAACCTCTTTATCTTCTCGAGAAGATAAAGAGGTTCCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1152s1c1
Sequence:CCGGCCCTTTAATAGCACCAGCCATCTCGAGATGGCTGGTGCTATTAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1125s1c1
Sequence:CCGGGCAGGAGGAAATGCTTCTCATCTCGAGATGAGAAGCATTTCCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008426
KCNJ3 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1486s1c1
Sequence:CCGGCCTACCAGGATGGAAGGAAATCTCGAGATTTCCTTCCATCCTGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1345s1c1
Sequence:CCGGCCCATGAAACTCCAACGAATACTCGAGTATTCGTTGGAGTTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-285s1c1
Sequence:CCGGGCGTTGGAACCTCTTTATCTTCTCGAGAAGATAAAGAGGTTCCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1152s1c1
Sequence:CCGGCCCTTTAATAGCACCAGCCATCTCGAGATGGCTGGTGCTATTAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008426.1-1125s1c1
Sequence:CCGGGCAGGAGGAAATGCTTCTCATCTCGAGATGAGAAGCATTTCCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)