EMAIL THIS PAGE TO A FRIEND

KCNJ4

potassium inwardly-rectifying channel, subfamily J, member 4

66 Gene Product Result for
Synonyms: HIR HIRK2 HRK1 IRK-3 IRK3 Kir2.3
UniProtKB ID: P48050, Q14D44
Gene ID:
Human(3761) Summary: Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16520) potassium inwardly-rectifying channel, subfamily J, member 4
Rat(116649) potassium inwardly-rectifying channel, subfamily J, member 4
sheep(101104736) potassium inwardly-rectifying channel, subfamily J, member 4
Domestic Rabbit(100338640) potassium inwardly-rectifying channel, subfamily J, member 4
domestic guinea pig(100169697) potassium inwardly-rectifying channel, subfamily J, member 4
naked mole-rat(101707326) potassium inwardly-rectifying channel, subfamily J, member 4
chicken(395903) potassium inwardly-rectifying channel, subfamily J, member 4
cow(101906792) potassium inwardly-rectifying channel, subfamily J, member 4
domestic cat(101101573) potassium inwardly-rectifying channel, subfamily J, member 4
dog(481253) potassium inwardly-rectifying channel, subfamily J, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004981 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131111 MISSION® esiRNA esiRNA human KCNJ4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004981 Rosetta Predictions human pricing
NM_152868 Rosetta Predictions human pricing
NM_053870 Rosetta Predictions rat pricing
NM_008427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178475 predicted 1325
2 SASI_Hs01_00178476 predicted 758
3 SASI_Hs01_00178477 predicted 1071
4 SASI_Hs01_00178478 predicted 895
5 SASI_Hs02_00338686 predicted 1226
6 SASI_Hs01_00178479 predicted 1004
7 SASI_Hs01_00178480 predicted 899
8 SASI_Hs02_00338687 predicted 1229
9 SASI_Hs01_00178482 predicted 1381
10 SASI_Hs01_00178483 predicted 660
11 SASI_Hs01_00178481 predicted 1053
12 SASI_Hs01_00178484 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180367 predicted 1482
2 SASI_Hs01_00180368 predicted 914
3 SASI_Hs01_00180369 predicted 1234
4 SASI_Hs01_00180370 predicted 1060
5 SASI_Hs02_00366810 predicted 1386
6 SASI_Hs01_00180371 predicted 1164
7 SASI_Hs01_00180372 predicted 1064
8 SASI_Hs02_00366811 predicted 1388
9 SASI_Hs01_00180374 predicted 1545
10 SASI_Hs01_00180375 predicted 819
11 SASI_Hs01_00180373 predicted 1212
12 SASI_Hs01_00180376 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034232 predicted 1995
2 SASI_Rn01_00034233 predicted 2012
3 SASI_Rn01_00034234 predicted 1824
4 SASI_Rn01_00034237 predicted 1375
5 SASI_Rn01_00034238 predicted 704
6 SASI_Rn01_00034239 predicted 1589
7 SASI_Rn01_00034240 predicted 1574
8 SASI_Rn01_00034241 predicted 1583
9 SASI_Rn02_00266762 predicted 714
10 SASI_Rn02_00266763 predicted 994
11 SASI_Rn01_00034235 predicted 1409
12 SASI_Rn01_00034236 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170904 predicted 777
2 SASI_Mm01_00170905 predicted 1064
3 SASI_Mm01_00170906 predicted 897
4 SASI_Mm01_00170907 predicted 1035
5 SASI_Mm01_00170908 predicted 425
6 SASI_Mm01_00170909 predicted 1079
7 SASI_Mm01_00170910 predicted 251
8 SASI_Mm01_00170911 predicted 1087
9 SASI_Mm01_00170912 predicted 687
10 SASI_Mm01_00170913 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008427
KCNJ4 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-863s1c1
Sequence:CCGGCCATCATCATAGTGCATGAAACTCGAGTTTCATGCACTATGATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-168s1c1
Sequence:CCGGCGGCCAGTGTAACGTCTACTTCTCGAGAAGTAGACGTTACACTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-258s1c1
Sequence:CCGGGCGCTATATGCTCATGATCTTCTCGAGAAGATCATGAGCATATAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-1390s1c1
Sequence:CCGGCCACTGGACAATATTTCCTATCTCGAGATAGGAAATATTGTCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-753s1c1
Sequence:CCGGCCAGCTCATCAAACCCTACATCTCGAGATGTAGGGTTTGATGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008427
KCNJ4 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-863s1c1
Sequence:CCGGCCATCATCATAGTGCATGAAACTCGAGTTTCATGCACTATGATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-168s1c1
Sequence:CCGGCGGCCAGTGTAACGTCTACTTCTCGAGAAGTAGACGTTACACTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-258s1c1
Sequence:CCGGGCGCTATATGCTCATGATCTTCTCGAGAAGATCATGAGCATATAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-1390s1c1
Sequence:CCGGCCACTGGACAATATTTCCTATCTCGAGATAGGAAATATTGTCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-753s1c1
Sequence:CCGGCCAGCTCATCAAACCCTACATCTCGAGATGTAGGGTTTGATGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008427
KCNJ4 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-863s1c1
Sequence:CCGGCCATCATCATAGTGCATGAAACTCGAGTTTCATGCACTATGATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-168s1c1
Sequence:CCGGCGGCCAGTGTAACGTCTACTTCTCGAGAAGTAGACGTTACACTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-258s1c1
Sequence:CCGGGCGCTATATGCTCATGATCTTCTCGAGAAGATCATGAGCATATAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-1390s1c1
Sequence:CCGGCCACTGGACAATATTTCCTATCTCGAGATAGGAAATATTGTCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008427.2-753s1c1
Sequence:CCGGCCAGCTCATCAAACCCTACATCTCGAGATGTAGGGTTTGATGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004981
KCNJ4 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-325s1c1
Sequence:CCGGCTTCTGGTGTATCGCCTTCTTCTCGAGAAGAAGGCGATACACCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-904s1c1
Sequence:CCGGCCCGCTTTATGGCATGGGCAACTCGAGTTGCCCATGCCATAAAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-760s1c1
Sequence:CCGGCCAGCTCATCAAGCCCTACATCTCGAGATGTAGGGCTTGATGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-1393s1c1
Sequence:CCGGCCCGCTGGACAACATCTCCTACTCGAGTAGGAGATGTTGTCCAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-172s1c1
Sequence:CCGGCGGCCAATGCAACGTGTACTTCTCGAGAAGTACACGTTGCATTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004981.1-1218s21c1
Sequence:CCGGAGAACGAGCTGGCCCTTATGACTCGAGTCATAAGGGCCAGCTCGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004981.1-1705s21c1
Sequence:CCGGTTCAAGGACGTGCCCTCTTTGCTCGAGCAAAGAGGGCACGTCCTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004981.1-205s21c1
Sequence:CCGGCAACAAGTCGCAGCGCTACATCTCGAGATGTAGCGCTGCGACTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004981.1-1084s21c1
Sequence:CCGGCAAGGTGGACTACTCACGTTTCTCGAGAAACGTGAGTAGTCCACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004981
KCNJ4 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-325s1c1
Sequence:CCGGCTTCTGGTGTATCGCCTTCTTCTCGAGAAGAAGGCGATACACCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-904s1c1
Sequence:CCGGCCCGCTTTATGGCATGGGCAACTCGAGTTGCCCATGCCATAAAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-760s1c1
Sequence:CCGGCCAGCTCATCAAGCCCTACATCTCGAGATGTAGGGCTTGATGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-1393s1c1
Sequence:CCGGCCCGCTGGACAACATCTCCTACTCGAGTAGGAGATGTTGTCCAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-172s1c1
Sequence:CCGGCGGCCAATGCAACGTGTACTTCTCGAGAAGTACACGTTGCATTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004981.1-1218s21c1
Sequence:CCGGAGAACGAGCTGGCCCTTATGACTCGAGTCATAAGGGCCAGCTCGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004981.1-1705s21c1
Sequence:CCGGTTCAAGGACGTGCCCTCTTTGCTCGAGCAAAGAGGGCACGTCCTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004981.1-205s21c1
Sequence:CCGGCAACAAGTCGCAGCGCTACATCTCGAGATGTAGCGCTGCGACTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004981.1-1084s21c1
Sequence:CCGGCAAGGTGGACTACTCACGTTTCTCGAGAAACGTGAGTAGTCCACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004981
KCNJ4 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-325s1c1
Sequence:CCGGCTTCTGGTGTATCGCCTTCTTCTCGAGAAGAAGGCGATACACCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-904s1c1
Sequence:CCGGCCCGCTTTATGGCATGGGCAACTCGAGTTGCCCATGCCATAAAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-760s1c1
Sequence:CCGGCCAGCTCATCAAGCCCTACATCTCGAGATGTAGGGCTTGATGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-1393s1c1
Sequence:CCGGCCCGCTGGACAACATCTCCTACTCGAGTAGGAGATGTTGTCCAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004981.1-172s1c1
Sequence:CCGGCGGCCAATGCAACGTGTACTTCTCGAGAAGTACACGTTGCATTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004981.1-1218s21c1
Sequence:CCGGAGAACGAGCTGGCCCTTATGACTCGAGTCATAAGGGCCAGCTCGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004981.1-1705s21c1
Sequence:CCGGTTCAAGGACGTGCCCTCTTTGCTCGAGCAAAGAGGGCACGTCCTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004981.1-205s21c1
Sequence:CCGGCAACAAGTCGCAGCGCTACATCTCGAGATGTAGCGCTGCGACTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004981.1-1084s21c1
Sequence:CCGGCAAGGTGGACTACTCACGTTTCTCGAGAAACGTGAGTAGTCCACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)