EMAIL THIS PAGE TO A FRIEND

KCNJ5

potassium inwardly-rectifying channel, subfamily J, member 5

80 Gene Product Result for
Synonyms: CIR GIRK4 KATP1 KIR3.4 LQT13
UniProtKB ID: P48544, B2R744, Q6DK13, Q6DK14, Q92807
Gene ID:
Human(3762) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It may associate with two other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
Mouse(16521) potassium inwardly-rectifying channel, subfamily J, member 5
Rat(29713) potassium inwardly-rectifying channel, subfamily J, member 5
Zebrafish(571888) potassium inwardly-rectifying channel, subfamily J, member 5
cow(539844) potassium inwardly-rectifying channel, subfamily J, member 5
Horse(100064621) potassium inwardly-rectifying channel, subfamily J, member 5
domestic cat(101091726) potassium inwardly-rectifying channel, subfamily J, member 5
dog(489284) potassium inwardly-rectifying channel, subfamily J, member 5
chicken(395925) potassium inwardly-rectifying channel, subfamily J, member 5
domestic guinea pig(100722552) potassium inwardly-rectifying channel, subfamily J, member 5
naked mole-rat(101720856) potassium inwardly-rectifying channel, subfamily J, member 5
sheep(101116101) potassium inwardly-rectifying channel, subfamily J, member 5
Domestic Rabbit(100352473) potassium inwardly-rectifying channel, subfamily J, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P154 Pinacidil monohydrate powder mouse, rat pricing
C1055 Cromakalim rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000890 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010521 MISSION® esiRNA esiRNA targeting human KCNJ5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000890 Rosetta Predictions human pricing
NM_017297 Rosetta Predictions rat pricing
XM_001054644 Rosetta Predictions rat pricing
XM_001056941 Rosetta Predictions rat pricing
NM_010605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190507 predicted 687
2 SASI_Hs01_00190508 predicted 1992
3 SASI_Hs01_00190509 predicted 1017
4 SASI_Hs01_00190510 predicted 1197
5 SASI_Hs01_00190511 predicted 1129
6 SASI_Hs01_00190512 predicted 573
7 SASI_Hs01_00190513 predicted 1987
8 SASI_Hs01_00190514 predicted 2038
9 SASI_Hs01_00190516 predicted 1071
10 SASI_Hs02_00303442 predicted 2000
11 SASI_Hs01_00190515 predicted 2063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261735 predicted 1529
2 SASI_Rn01_00116027 predicted 463
3 SASI_Rn01_00116028 predicted 1495
4 SASI_Rn01_00116029 predicted 372
5 SASI_Rn01_00116030 predicted 1130
6 SASI_Rn01_00116031 predicted 1193
7 SASI_Rn01_00116032 predicted 434
8 SASI_Rn01_00116033 predicted 613
9 SASI_Rn02_00261736 predicted 717
10 SASI_Rn01_00116034 predicted 1510
11 SASI_Rn01_00116035 predicted 610
12 SASI_Rn01_00116036 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276617 predicted 253
2 SASI_Rn02_00276618 predicted 466
3 SASI_Rn02_00276619 predicted 465
4 SASI_Rn02_00276620 predicted 381
5 SASI_Rn02_00276621 predicted 376
6 SASI_Rn02_00276622 predicted 433
7 SASI_Rn02_00276623 predicted 423
8 SASI_Rn02_00276624 predicted 341
9 SASI_Rn02_00276625 predicted 430
10 SASI_Rn02_00276626 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284919 predicted 581
2 SASI_Rn02_00284920 predicted 626
3 SASI_Rn02_00284921 predicted 721
4 SASI_Rn02_00284922 predicted 461
5 SASI_Rn02_00284923 predicted 758
6 SASI_Rn02_00284924 predicted 624
7 SASI_Rn02_00284925 predicted 383
8 SASI_Rn02_00284926 predicted 546
9 SASI_Rn02_00284927 predicted 617
10 SASI_Rn02_00284928 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023719 predicted 1323
2 SASI_Mm01_00023720 predicted 643
3 SASI_Mm01_00023721 predicted 1396
4 SASI_Mm01_00023722 predicted 696
5 SASI_Mm01_00023723 predicted 873
6 SASI_Mm01_00023724 predicted 1146
7 SASI_Mm01_00023725 predicted 929
8 SASI_Mm01_00023726 predicted 1338
9 SASI_Mm01_00023727 predicted 439
10 SASI_Mm02_00318920 predicted 1197
11 SASI_Mm01_00023728 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000890
KCNJ5 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-2052s21c1
Sequence:CCGGGAGTTAAGATCCATCCATATCCTCGAGGATATGGATGGATCTTAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-1938s21c1
Sequence:CCGGCCATCACCTTGTCCCTCATTCCTCGAGGAATGAGGGACAAGGTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-2058s21c1
Sequence:CCGGAGATCCATCCATATCACATAGCTCGAGCTATGTGATATGGATGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-1998s21c1
Sequence:CCGGTTACCTGATGAGAGCTCAAACCTCGAGGTTTGAGCTCTCATCAGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000890.3-2226s1c1
Sequence:CCGGGTCTCATTAGAGTGACTCTTACTCGAGTAAGAGTCACTCTAATGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-584s1c1
Sequence:CCGGGCTCGTCTTCACCATGGTTTACTCGAGTAAACCATGGTGAAGACGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-1077s1c1
Sequence:CCGGACAGACATCAACGTGGGCTTTCTCGAGAAAGCCCACGTTGATGTCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-1191s1c1
Sequence:CCGGCAGCTGCATCAGGAAGAGTTTCTCGAGAAACTCTTCCTGATGCAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-749s1c1
Sequence:CCGGGACCGAAACAACCATTGGGTACTCGAGTACCCAATGGTTGTTTCGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000890
KCNJ5 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-2052s21c1
Sequence:CCGGGAGTTAAGATCCATCCATATCCTCGAGGATATGGATGGATCTTAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-1938s21c1
Sequence:CCGGCCATCACCTTGTCCCTCATTCCTCGAGGAATGAGGGACAAGGTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-2058s21c1
Sequence:CCGGAGATCCATCCATATCACATAGCTCGAGCTATGTGATATGGATGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-1998s21c1
Sequence:CCGGTTACCTGATGAGAGCTCAAACCTCGAGGTTTGAGCTCTCATCAGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000890.3-2226s1c1
Sequence:CCGGGTCTCATTAGAGTGACTCTTACTCGAGTAAGAGTCACTCTAATGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-584s1c1
Sequence:CCGGGCTCGTCTTCACCATGGTTTACTCGAGTAAACCATGGTGAAGACGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-1077s1c1
Sequence:CCGGACAGACATCAACGTGGGCTTTCTCGAGAAAGCCCACGTTGATGTCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-1191s1c1
Sequence:CCGGCAGCTGCATCAGGAAGAGTTTCTCGAGAAACTCTTCCTGATGCAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-749s1c1
Sequence:CCGGGACCGAAACAACCATTGGGTACTCGAGTACCCAATGGTTGTTTCGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000890
KCNJ5 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-2052s21c1
Sequence:CCGGGAGTTAAGATCCATCCATATCCTCGAGGATATGGATGGATCTTAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-1938s21c1
Sequence:CCGGCCATCACCTTGTCCCTCATTCCTCGAGGAATGAGGGACAAGGTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-2058s21c1
Sequence:CCGGAGATCCATCCATATCACATAGCTCGAGCTATGTGATATGGATGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000890.3-1998s21c1
Sequence:CCGGTTACCTGATGAGAGCTCAAACCTCGAGGTTTGAGCTCTCATCAGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000890.3-2226s1c1
Sequence:CCGGGTCTCATTAGAGTGACTCTTACTCGAGTAAGAGTCACTCTAATGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-584s1c1
Sequence:CCGGGCTCGTCTTCACCATGGTTTACTCGAGTAAACCATGGTGAAGACGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-1077s1c1
Sequence:CCGGACAGACATCAACGTGGGCTTTCTCGAGAAAGCCCACGTTGATGTCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-1191s1c1
Sequence:CCGGCAGCTGCATCAGGAAGAGTTTCTCGAGAAACTCTTCCTGATGCAGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000890.3-749s1c1
Sequence:CCGGGACCGAAACAACCATTGGGTACTCGAGTACCCAATGGTTGTTTCGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010605
KCNJ5 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-213s1c1
Sequence:CCGGCCGTTACCTAAGTGACCTCTTCTCGAGAAGAGGTCACTTAGGTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-525s1c1
Sequence:CCGGCTCGATTGTTAATGCCTTCATCTCGAGATGAAGGCATTAACAATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-726s1c1
Sequence:CCGGGCAGACCAAAGAAGGAGAATTCTCGAGAATTCTCCTTCTTTGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-61s1c1
Sequence:CCGGGACCACAAGAAGATTCCCAAACTCGAGTTTGGGAATCTTCTTGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-1001s1c1
Sequence:CCGGCACCAGTTCTCACCTTGGAAACTCGAGTTTCCAAGGTGAGAACTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010605
KCNJ5 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-213s1c1
Sequence:CCGGCCGTTACCTAAGTGACCTCTTCTCGAGAAGAGGTCACTTAGGTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-525s1c1
Sequence:CCGGCTCGATTGTTAATGCCTTCATCTCGAGATGAAGGCATTAACAATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-726s1c1
Sequence:CCGGGCAGACCAAAGAAGGAGAATTCTCGAGAATTCTCCTTCTTTGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-61s1c1
Sequence:CCGGGACCACAAGAAGATTCCCAAACTCGAGTTTGGGAATCTTCTTGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-1001s1c1
Sequence:CCGGCACCAGTTCTCACCTTGGAAACTCGAGTTTCCAAGGTGAGAACTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010605
KCNJ5 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-213s1c1
Sequence:CCGGCCGTTACCTAAGTGACCTCTTCTCGAGAAGAGGTCACTTAGGTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-525s1c1
Sequence:CCGGCTCGATTGTTAATGCCTTCATCTCGAGATGAAGGCATTAACAATCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-726s1c1
Sequence:CCGGGCAGACCAAAGAAGGAGAATTCTCGAGAATTCTCCTTCTTTGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-61s1c1
Sequence:CCGGGACCACAAGAAGATTCCCAAACTCGAGTTTGGGAATCTTCTTGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010605.2-1001s1c1
Sequence:CCGGCACCAGTTCTCACCTTGGAAACTCGAGTTTCCAAGGTGAGAACTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)