EMAIL THIS PAGE TO A FRIEND

KCNJ8

potassium inwardly-rectifying channel, subfamily J, member 8

91 Gene Product Result for
Synonyms: KIR6.1 uKATP-1
UniProtKB ID: Q15842, O00657
Gene ID:
Human(3764) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. Defects in this gene may be a cause of J-wave syndromes and sudden infant death syndrome (SIDS). [provided by RefSeq, May 2012]
Mouse(16523) potassium inwardly-rectifying channel, subfamily J, member 8
Rat(25472) potassium inwardly-rectifying channel, subfamily J, member 8
Zebrafish(561090) potassium inwardly-rectifying channel, subfamily J, member 8
chicken(395973) potassium inwardly-rectifying channel, subfamily J, member 8
dog(486639) potassium inwardly-rectifying channel, subfamily J, member 8
Horse(100064325) potassium inwardly-rectifying channel, subfamily J, member 8
cow(282572) potassium inwardly-rectifying channel, subfamily J, member 8
domestic cat(101092773) potassium inwardly-rectifying channel, subfamily J, member 8
domestic guinea pig(100379255) potassium inwardly-rectifying channel, subfamily J, member 8
naked mole-rat(101698456) potassium inwardly-rectifying channel, subfamily J, member 8
sheep(101118008) potassium inwardly-rectifying channel, subfamily J, member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Activator

Product # Description Species Add to Cart
 
D9035 Diazoxide human, mouse, rat pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
C1055 Cromakalim rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
P154 Pinacidil monohydrate powder mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004982 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027811 MISSION® esiRNA esiRNA human KCNJ8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004982 Rosetta Predictions human pricing
NM_017099 Rosetta Predictions rat pricing
NM_008428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338688 predicted 474
2 SASI_Hs02_00338689 predicted 1888
3 SASI_Hs01_00113359 predicted 926
4 SASI_Hs01_00113360 predicted 833
5 SASI_Hs02_00338690 predicted 848
6 SASI_Hs01_00113362 predicted 1087
7 SASI_Hs01_00113364 predicted 1083
8 SASI_Hs01_00113366 predicted 348
9 SASI_Hs02_00338691 predicted 1820
10 SASI_Hs02_00338692 predicted 339
11 SASI_Hs01_00113357 predicted 1456
12 SASI_Hs01_00113358 predicted 1428
13 SASI_Hs01_00113361 predicted 1323
14 SASI_Hs01_00113363 predicted 1697
15 SASI_Hs01_00113365 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118736 predicted 1186
2 SASI_Rn01_00118738 predicted 965
3 SASI_Rn01_00118739 predicted 1172
4 SASI_Rn02_00261320 predicted 1168
5 SASI_Rn01_00118741 predicted 671
6 SASI_Rn01_00118742 predicted 767
7 SASI_Rn01_00118743 predicted 768
8 SASI_Rn01_00118744 predicted 926
9 SASI_Rn01_00118745 predicted 942
10 SASI_Rn02_00261321 predicted 777
11 SASI_Rn01_00118737 predicted 1506
12 SASI_Rn01_00118740 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313893 predicted 739
2 SASI_Mm01_00031517 predicted 1537
3 SASI_Mm01_00031518 predicted 1005
4 SASI_Mm02_00313894 predicted 1616
5 SASI_Mm02_00313895 predicted 256
6 SASI_Mm02_00313896 predicted 1496
7 SASI_Mm02_00313897 predicted 753
8 SASI_Mm02_00313898 predicted 257
9 SASI_Mm01_00031521 predicted 374
10 SASI_Mm01_00031522 predicted 836
11 SASI_Mm01_00031519 predicted 778
12 SASI_Mm01_00031520 predicted 664
13 SASI_Mm01_00031523 predicted 1529
14 SASI_Mm01_00031524 predicted 1079
15 SASI_Mm01_00031525 predicted 1168
16 SASI_Mm01_00031526 predicted 1134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004982
VALIDATED
KCNJ8 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1132s21c1
Sequence:CCGGTGATCATCTGCCACGTGATTGCTCGAGCAATCACGTGGCAGATGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004982.2-1202s21c1
Sequence:CCGGAGACTTGGAGGTCATAGTTATCTCGAGATAACTATGACCTCCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1094s21c1
Sequence:CCGGCCCAATCGAGAGCAATAACATCTCGAGATGTTATTGCTCTCGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1752s21c1
Sequence:CCGGCAGCACTTTCTGTAGTAATAACTCGAGTTATTACTACAGAAAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-849s1c1
Sequence:CCGGGCAGTCATGTTAGGCTGCATTCTCGAGAATGCAGCCTAACATGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-1094s1c1
Sequence:CCGGCCCAATCGAGAGCAATAACATCTCGAGATGTTATTGCTCTCGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-477s1c1
Sequence:CCGGCATAAGAACATCCGTGAGCAACTCGAGTTGCTCACGGATGTTCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-1566s1c1
Sequence:CCGGGTGCAATTTATGACTCCAGAACTCGAGTTCTGGAGTCATAAATTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004982.2-2082s1c1
Sequence:CCGGCCATGATAACTGCATTTGGTACTCGAGTACCAAATGCAGTTATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1566s21c1
Sequence:CCGGGTGCAATTTATGACTCCAGAACTCGAGTTCTGGAGTCATAAATTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004982
VALIDATED
KCNJ8 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1132s21c1
Sequence:CCGGTGATCATCTGCCACGTGATTGCTCGAGCAATCACGTGGCAGATGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004982.2-1202s21c1
Sequence:CCGGAGACTTGGAGGTCATAGTTATCTCGAGATAACTATGACCTCCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1094s21c1
Sequence:CCGGCCCAATCGAGAGCAATAACATCTCGAGATGTTATTGCTCTCGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1752s21c1
Sequence:CCGGCAGCACTTTCTGTAGTAATAACTCGAGTTATTACTACAGAAAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-849s1c1
Sequence:CCGGGCAGTCATGTTAGGCTGCATTCTCGAGAATGCAGCCTAACATGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-1094s1c1
Sequence:CCGGCCCAATCGAGAGCAATAACATCTCGAGATGTTATTGCTCTCGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-477s1c1
Sequence:CCGGCATAAGAACATCCGTGAGCAACTCGAGTTGCTCACGGATGTTCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-1566s1c1
Sequence:CCGGGTGCAATTTATGACTCCAGAACTCGAGTTCTGGAGTCATAAATTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004982.2-2082s1c1
Sequence:CCGGCCATGATAACTGCATTTGGTACTCGAGTACCAAATGCAGTTATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1566s21c1
Sequence:CCGGGTGCAATTTATGACTCCAGAACTCGAGTTCTGGAGTCATAAATTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004982
VALIDATED
KCNJ8 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1132s21c1
Sequence:CCGGTGATCATCTGCCACGTGATTGCTCGAGCAATCACGTGGCAGATGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004982.2-1202s21c1
Sequence:CCGGAGACTTGGAGGTCATAGTTATCTCGAGATAACTATGACCTCCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1094s21c1
Sequence:CCGGCCCAATCGAGAGCAATAACATCTCGAGATGTTATTGCTCTCGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1752s21c1
Sequence:CCGGCAGCACTTTCTGTAGTAATAACTCGAGTTATTACTACAGAAAGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-849s1c1
Sequence:CCGGGCAGTCATGTTAGGCTGCATTCTCGAGAATGCAGCCTAACATGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-1094s1c1
Sequence:CCGGCCCAATCGAGAGCAATAACATCTCGAGATGTTATTGCTCTCGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-477s1c1
Sequence:CCGGCATAAGAACATCCGTGAGCAACTCGAGTTGCTCACGGATGTTCTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004982.2-1566s1c1
Sequence:CCGGGTGCAATTTATGACTCCAGAACTCGAGTTCTGGAGTCATAAATTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004982.2-2082s1c1
Sequence:CCGGCCATGATAACTGCATTTGGTACTCGAGTACCAAATGCAGTTATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004982.2-1566s21c1
Sequence:CCGGGTGCAATTTATGACTCCAGAACTCGAGTTCTGGAGTCATAAATTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008428
KCNJ8 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1128s1c1
Sequence:CCGGGCAACTGACCTTGCCAATCAACTCGAGTTGATTGGCAAGGTCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1282s1c1
Sequence:CCGGGCGTGTACTCTGTGGACTATTCTCGAGAATAGTCCACAGAGTACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1019s1c1
Sequence:CCGGGCAGGACATTCCTGTTGATAACTCGAGTTATCAACAGGAATGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1008s1c1
Sequence:CCGGCCTATTCATCAGCAGGACATTCTCGAGAATGTCCTGCTGATGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-584s1c1
Sequence:CCGGCATCTATGCTTACATGGAGAACTCGAGTTCTCCATGTAAGCATAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008428
KCNJ8 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1128s1c1
Sequence:CCGGGCAACTGACCTTGCCAATCAACTCGAGTTGATTGGCAAGGTCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1282s1c1
Sequence:CCGGGCGTGTACTCTGTGGACTATTCTCGAGAATAGTCCACAGAGTACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1019s1c1
Sequence:CCGGGCAGGACATTCCTGTTGATAACTCGAGTTATCAACAGGAATGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1008s1c1
Sequence:CCGGCCTATTCATCAGCAGGACATTCTCGAGAATGTCCTGCTGATGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-584s1c1
Sequence:CCGGCATCTATGCTTACATGGAGAACTCGAGTTCTCCATGTAAGCATAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008428
KCNJ8 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1128s1c1
Sequence:CCGGGCAACTGACCTTGCCAATCAACTCGAGTTGATTGGCAAGGTCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1282s1c1
Sequence:CCGGGCGTGTACTCTGTGGACTATTCTCGAGAATAGTCCACAGAGTACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1019s1c1
Sequence:CCGGGCAGGACATTCCTGTTGATAACTCGAGTTATCAACAGGAATGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-1008s1c1
Sequence:CCGGCCTATTCATCAGCAGGACATTCTCGAGAATGTCCTGCTGATGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008428.2-584s1c1
Sequence:CCGGCATCTATGCTTACATGGAGAACTCGAGTTCTCCATGTAAGCATAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)