EMAIL THIS PAGE TO A FRIEND

KCNK10

potassium channel, subfamily K, member 10

131 Gene Product Result for
Synonyms: K2p10.1 TREK-2 TREK2
Gene ID:
Human(54207) Summary: The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations, and is stimulated strongly by arachidonic acid and to a lesser degree by membrane stretching, intracellular acidification, and general anaesthetics. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
Mouse(72258) potassium channel, subfamily K, member 10
Rat(65272) potassium channel, subfamily K, member 10
sheep(101113681) potassium channel, subfamily K, member 10
Domestic Rabbit(100009503) potassium channel, subfamily K, member 10
domestic guinea pig(100732026) potassium channel, subfamily K, member 10
naked mole-rat(101721172) potassium channel, subfamily K, member 10
chicken(428902) potassium channel, subfamily K, member 10
domestic cat(101091456) potassium channel, subfamily K, member 10
cow(525109) potassium channel, subfamily K, member 10
Horse(100061881) potassium channel, subfamily K, member 10
dog(490822) potassium channel, subfamily K, member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021161 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021161 Rosetta Predictions human pricing
NM_138317 Rosetta Predictions human pricing
NM_138318 Rosetta Predictions human pricing
NM_023096 Rosetta Predictions rat pricing
NM_029911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354711 predicted 940
2 SASI_Hs01_00085703 predicted 710
3 SASI_Hs01_00085704 predicted 1058
4 SASI_Hs01_00085705 predicted 1686
5 SASI_Hs01_00085707 predicted 938
6 SASI_Hs02_00354712 predicted 1393
7 SASI_Hs01_00085708 predicted 1241
8 SASI_Hs01_00085709 predicted 775
9 SASI_Hs01_00085710 predicted 1321
10 SASI_Hs02_00354713 predicted 778
11 SASI_Hs01_00085706 predicted 1710
12 SASI_Hs01_00085711 predicted 1677
13 SASI_Hs01_00085712 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363402 predicted 712
2 SASI_Hs01_00048720 predicted 477
3 SASI_Hs01_00048721 predicted 827
4 SASI_Hs01_00048722 predicted 1456
5 SASI_Hs01_00048724 predicted 705
6 SASI_Hs02_00363403 predicted 1155
7 SASI_Hs01_00048725 predicted 1015
8 SASI_Hs01_00048726 predicted 542
9 SASI_Hs01_00048727 predicted 1080
10 SASI_Hs02_00363404 predicted 543
11 SASI_Hs01_00048723 predicted 1475
12 SASI_Hs01_00048728 predicted 1437
13 SASI_Hs01_00048729 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363405 predicted 629
2 SASI_Hs01_00236621 predicted 394
3 SASI_Hs01_00236622 predicted 751
4 SASI_Hs01_00236623 predicted 1376
5 SASI_Hs01_00236625 predicted 620
6 SASI_Hs02_00363406 predicted 1076
7 SASI_Hs01_00236626 predicted 925
8 SASI_Hs01_00236627 predicted 465
9 SASI_Hs01_00236628 predicted 997
10 SASI_Hs02_00363407 predicted 462
11 SASI_Hs01_00236624 predicted 1392
12 SASI_Hs01_00236629 predicted 1354
13 SASI_Hs01_00236630 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119096 predicted 684
2 SASI_Rn01_00119097 predicted 1388
3 SASI_Rn01_00119098 predicted 542
4 SASI_Rn01_00119099 predicted 553
5 SASI_Rn01_00119100 predicted 976
6 SASI_Rn01_00119101 predicted 849
7 SASI_Rn01_00119102 predicted 1606
8 SASI_Rn01_00119103 predicted 1157
9 SASI_Rn01_00119104 predicted 868
10 SASI_Rn01_00119105 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064371 predicted 1346
2 SASI_Mm01_00064372 predicted 598
3 SASI_Mm01_00064373 predicted 426
4 SASI_Mm01_00064374 predicted 195
5 SASI_Mm01_00064375 predicted 474
6 SASI_Mm01_00064376 predicted 429
7 SASI_Mm01_00064377 predicted 794
8 SASI_Mm01_00064378 predicted 895
9 SASI_Mm01_00064379 predicted 460
10 SASI_Mm01_00064380 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021161
KCNK10 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-752s1c1
Sequence:CCGGCCAGAAGAATACCATCGCCTTCTCGAGAAGGCGATGGTATTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-1239s1c1
Sequence:CCGGGCCTTGGAGTCCATTTACTTTCTCGAGAAAGTAAATGGACTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-1050s1c1
Sequence:CCGGGCTGGAATTGGAGACCAACTTCTCGAGAAGTTGGTCTCCAATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-1392s1c1
Sequence:CCGGGTCCTCAGTATGATCGGAGATCTCGAGATCTCCGATCATACTGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-2034s1c1
Sequence:CCGGCCGGAGAACAACTCATTACTTCTCGAGAAGTAATGAGTTGTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021161.4-1327s21c1
Sequence:CCGGCAATTATCGGGAGTGGTATAACTCGAGTTATACCACTCCCGATAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021161.4-864s21c1
Sequence:CCGGATGCGGGAGTCAGTCCAATAGCTCGAGCTATTGGACTGACTCCCGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021161
KCNK10 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-752s1c1
Sequence:CCGGCCAGAAGAATACCATCGCCTTCTCGAGAAGGCGATGGTATTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-1239s1c1
Sequence:CCGGGCCTTGGAGTCCATTTACTTTCTCGAGAAAGTAAATGGACTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-1050s1c1
Sequence:CCGGGCTGGAATTGGAGACCAACTTCTCGAGAAGTTGGTCTCCAATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-1392s1c1
Sequence:CCGGGTCCTCAGTATGATCGGAGATCTCGAGATCTCCGATCATACTGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-2034s1c1
Sequence:CCGGCCGGAGAACAACTCATTACTTCTCGAGAAGTAATGAGTTGTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021161.4-1327s21c1
Sequence:CCGGCAATTATCGGGAGTGGTATAACTCGAGTTATACCACTCCCGATAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021161.4-864s21c1
Sequence:CCGGATGCGGGAGTCAGTCCAATAGCTCGAGCTATTGGACTGACTCCCGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021161
KCNK10 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-752s1c1
Sequence:CCGGCCAGAAGAATACCATCGCCTTCTCGAGAAGGCGATGGTATTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-1239s1c1
Sequence:CCGGGCCTTGGAGTCCATTTACTTTCTCGAGAAAGTAAATGGACTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-1050s1c1
Sequence:CCGGGCTGGAATTGGAGACCAACTTCTCGAGAAGTTGGTCTCCAATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-1392s1c1
Sequence:CCGGGTCCTCAGTATGATCGGAGATCTCGAGATCTCCGATCATACTGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021161.3-2034s1c1
Sequence:CCGGCCGGAGAACAACTCATTACTTCTCGAGAAGTAATGAGTTGTTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021161.4-1327s21c1
Sequence:CCGGCAATTATCGGGAGTGGTATAACTCGAGTTATACCACTCCCGATAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021161.4-864s21c1
Sequence:CCGGATGCGGGAGTCAGTCCAATAGCTCGAGCTATTGGACTGACTCCCGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029911
KCNK10 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029911.2-1813s1c1
Sequence:CCGGCGTGCCTTAAATAGACTTCTTCTCGAGAAGAAGTCTATTTAAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-1608s1c1
Sequence:CCGGGCCATGCTGACAGAGTGTATACTCGAGTATACACTCTGTCAGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-467s1c1
Sequence:CCGGCCAGGAACTAGAGACACTGATCTCGAGATCAGTGTCTCTAGTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-1261s1c1
Sequence:CCGGCCCACTCACTGGACATGCTATCTCGAGATAGCATGTCCAGTGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-1533s1c1
Sequence:CCGGCGGAATTACTCTCTGGATGAACTCGAGTTCATCCAGAGAGTAATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029911
KCNK10 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029911.2-1813s1c1
Sequence:CCGGCGTGCCTTAAATAGACTTCTTCTCGAGAAGAAGTCTATTTAAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-1608s1c1
Sequence:CCGGGCCATGCTGACAGAGTGTATACTCGAGTATACACTCTGTCAGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-467s1c1
Sequence:CCGGCCAGGAACTAGAGACACTGATCTCGAGATCAGTGTCTCTAGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-1261s1c1
Sequence:CCGGCCCACTCACTGGACATGCTATCTCGAGATAGCATGTCCAGTGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-1533s1c1
Sequence:CCGGCGGAATTACTCTCTGGATGAACTCGAGTTCATCCAGAGAGTAATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029911
KCNK10 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029911.2-1813s1c1
Sequence:CCGGCGTGCCTTAAATAGACTTCTTCTCGAGAAGAAGTCTATTTAAGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-1608s1c1
Sequence:CCGGGCCATGCTGACAGAGTGTATACTCGAGTATACACTCTGTCAGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-467s1c1
Sequence:CCGGCCAGGAACTAGAGACACTGATCTCGAGATCAGTGTCTCTAGTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-1261s1c1
Sequence:CCGGCCCACTCACTGGACATGCTATCTCGAGATAGCATGTCCAGTGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029911.2-1533s1c1
Sequence:CCGGCGGAATTACTCTCTGGATGAACTCGAGTTCATCCAGAGAGTAATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)